ID: 1126239719

View in Genome Browser
Species Human (GRCh38)
Location 15:46427487-46427509
Sequence CAACATTAGATCAATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126239715_1126239719 16 Left 1126239715 15:46427448-46427470 CCCACACAATAATAATGGGAGAC 0: 3588
1: 5382
2: 2493
3: 1239
4: 1047
Right 1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG No data
1126239716_1126239719 15 Left 1126239716 15:46427449-46427471 CCACACAATAATAATGGGAGACT 0: 3585
1: 5527
2: 2752
3: 1484
4: 1003
Right 1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126239719 Original CRISPR CAACATTAGATCAATGAGAC AGG Intergenic
No off target data available for this crispr