ID: 1126241453

View in Genome Browser
Species Human (GRCh38)
Location 15:46449325-46449347
Sequence CAGAAAGTGGGGCAGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126241445_1126241453 8 Left 1126241445 15:46449294-46449316 CCCGCGCTGTAGCCTAGAAACTG No data
Right 1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG No data
1126241447_1126241453 -4 Left 1126241447 15:46449306-46449328 CCTAGAAACTGCCTCCAAGCAGA No data
Right 1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG No data
1126241446_1126241453 7 Left 1126241446 15:46449295-46449317 CCGCGCTGTAGCCTAGAAACTGC No data
Right 1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG No data
1126241443_1126241453 17 Left 1126241443 15:46449285-46449307 CCACTTCTCCCCGCGCTGTAGCC No data
Right 1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG No data
1126241444_1126241453 9 Left 1126241444 15:46449293-46449315 CCCCGCGCTGTAGCCTAGAAACT No data
Right 1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126241453 Original CRISPR CAGAAAGTGGGGCAGTTGTC AGG Intergenic
No off target data available for this crispr