ID: 1126244380

View in Genome Browser
Species Human (GRCh38)
Location 15:46487008-46487030
Sequence ATTGTTTTTCAAACAATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126244379_1126244380 -6 Left 1126244379 15:46486991-46487013 CCAGATTCATTCTCAGAATTGTT No data
Right 1126244380 15:46487008-46487030 ATTGTTTTTCAAACAATGACAGG No data
1126244378_1126244380 12 Left 1126244378 15:46486973-46486995 CCTTTTATTGGACTGTCTCCAGA No data
Right 1126244380 15:46487008-46487030 ATTGTTTTTCAAACAATGACAGG No data
1126244376_1126244380 28 Left 1126244376 15:46486957-46486979 CCACACTTCATTCTCACCTTTTA No data
Right 1126244380 15:46487008-46487030 ATTGTTTTTCAAACAATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126244380 Original CRISPR ATTGTTTTTCAAACAATGAC AGG Intergenic
No off target data available for this crispr