ID: 1126247851

View in Genome Browser
Species Human (GRCh38)
Location 15:46530333-46530355
Sequence ATGCCATGGGCTACTGGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126247851_1126247855 -6 Left 1126247851 15:46530333-46530355 CCTCGACCAGTAGCCCATGGCAT No data
Right 1126247855 15:46530350-46530372 TGGCATTCACTAATCTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126247851 Original CRISPR ATGCCATGGGCTACTGGTCG AGG (reversed) Intergenic