ID: 1126249399

View in Genome Browser
Species Human (GRCh38)
Location 15:46550312-46550334
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126249399_1126249404 16 Left 1126249399 15:46550312-46550334 CCATACAGAGAAGCTATTGTGCT No data
Right 1126249404 15:46550351-46550373 CCAGTGCAGCACAGCAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126249399 Original CRISPR AGCACAATAGCTTCTCTGTA TGG (reversed) Intergenic
No off target data available for this crispr