ID: 1126249404

View in Genome Browser
Species Human (GRCh38)
Location 15:46550351-46550373
Sequence CCAGTGCAGCACAGCAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126249398_1126249404 17 Left 1126249398 15:46550311-46550333 CCCATACAGAGAAGCTATTGTGC No data
Right 1126249404 15:46550351-46550373 CCAGTGCAGCACAGCAATATTGG No data
1126249399_1126249404 16 Left 1126249399 15:46550312-46550334 CCATACAGAGAAGCTATTGTGCT No data
Right 1126249404 15:46550351-46550373 CCAGTGCAGCACAGCAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126249404 Original CRISPR CCAGTGCAGCACAGCAATAT TGG Intergenic
No off target data available for this crispr