ID: 1126250631

View in Genome Browser
Species Human (GRCh38)
Location 15:46564269-46564291
Sequence AAGCATTATTGGCCCTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126250631_1126250636 27 Left 1126250631 15:46564269-46564291 CCTCTTTAGGGCCAATAATGCTT No data
Right 1126250636 15:46564319-46564341 TTTTTTATTTTAGATCCTGTAGG No data
1126250631_1126250633 -5 Left 1126250631 15:46564269-46564291 CCTCTTTAGGGCCAATAATGCTT No data
Right 1126250633 15:46564287-46564309 TGCTTAGATTTGCCCTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126250631 Original CRISPR AAGCATTATTGGCCCTAAAG AGG (reversed) Intergenic