ID: 1126250633

View in Genome Browser
Species Human (GRCh38)
Location 15:46564287-46564309
Sequence TGCTTAGATTTGCCCTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126250627_1126250633 14 Left 1126250627 15:46564250-46564272 CCTATCTCTTTCACTACCTCCTC No data
Right 1126250633 15:46564287-46564309 TGCTTAGATTTGCCCTTTTGAGG No data
1126250631_1126250633 -5 Left 1126250631 15:46564269-46564291 CCTCTTTAGGGCCAATAATGCTT No data
Right 1126250633 15:46564287-46564309 TGCTTAGATTTGCCCTTTTGAGG No data
1126250630_1126250633 -2 Left 1126250630 15:46564266-46564288 CCTCCTCTTTAGGGCCAATAATG No data
Right 1126250633 15:46564287-46564309 TGCTTAGATTTGCCCTTTTGAGG No data
1126250625_1126250633 24 Left 1126250625 15:46564240-46564262 CCTTTTTATCCCTATCTCTTTCA No data
Right 1126250633 15:46564287-46564309 TGCTTAGATTTGCCCTTTTGAGG No data
1126250626_1126250633 15 Left 1126250626 15:46564249-46564271 CCCTATCTCTTTCACTACCTCCT No data
Right 1126250633 15:46564287-46564309 TGCTTAGATTTGCCCTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126250633 Original CRISPR TGCTTAGATTTGCCCTTTTG AGG Intergenic