ID: 1126250636

View in Genome Browser
Species Human (GRCh38)
Location 15:46564319-46564341
Sequence TTTTTTATTTTAGATCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126250635_1126250636 -4 Left 1126250635 15:46564300-46564322 CCTTTTGAGGCTTTTTTTTTTTT No data
Right 1126250636 15:46564319-46564341 TTTTTTATTTTAGATCCTGTAGG No data
1126250631_1126250636 27 Left 1126250631 15:46564269-46564291 CCTCTTTAGGGCCAATAATGCTT No data
Right 1126250636 15:46564319-46564341 TTTTTTATTTTAGATCCTGTAGG No data
1126250630_1126250636 30 Left 1126250630 15:46564266-46564288 CCTCCTCTTTAGGGCCAATAATG No data
Right 1126250636 15:46564319-46564341 TTTTTTATTTTAGATCCTGTAGG No data
1126250632_1126250636 16 Left 1126250632 15:46564280-46564302 CCAATAATGCTTAGATTTGCCCT No data
Right 1126250636 15:46564319-46564341 TTTTTTATTTTAGATCCTGTAGG No data
1126250634_1126250636 -3 Left 1126250634 15:46564299-46564321 CCCTTTTGAGGCTTTTTTTTTTT No data
Right 1126250636 15:46564319-46564341 TTTTTTATTTTAGATCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126250636 Original CRISPR TTTTTTATTTTAGATCCTGT AGG Intergenic