ID: 1126257055

View in Genome Browser
Species Human (GRCh38)
Location 15:46640381-46640403
Sequence CCAGGATATCATTAGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126257055_1126257062 16 Left 1126257055 15:46640381-46640403 CCCTTTCCCTAATGATATCCTGG No data
Right 1126257062 15:46640420-46640442 ACCTCATTTCCCCACACCTTTGG No data
1126257055_1126257069 28 Left 1126257055 15:46640381-46640403 CCCTTTCCCTAATGATATCCTGG No data
Right 1126257069 15:46640432-46640454 CACACCTTTGGGGCCCACAGAGG No data
1126257055_1126257064 17 Left 1126257055 15:46640381-46640403 CCCTTTCCCTAATGATATCCTGG No data
Right 1126257064 15:46640421-46640443 CCTCATTTCCCCACACCTTTGGG No data
1126257055_1126257065 18 Left 1126257055 15:46640381-46640403 CCCTTTCCCTAATGATATCCTGG No data
Right 1126257065 15:46640422-46640444 CTCATTTCCCCACACCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126257055 Original CRISPR CCAGGATATCATTAGGGAAA GGG (reversed) Intergenic
No off target data available for this crispr