ID: 1126257057

View in Genome Browser
Species Human (GRCh38)
Location 15:46640382-46640404
Sequence CCCAGGATATCATTAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126257057_1126257065 17 Left 1126257057 15:46640382-46640404 CCTTTCCCTAATGATATCCTGGG No data
Right 1126257065 15:46640422-46640444 CTCATTTCCCCACACCTTTGGGG No data
1126257057_1126257069 27 Left 1126257057 15:46640382-46640404 CCTTTCCCTAATGATATCCTGGG No data
Right 1126257069 15:46640432-46640454 CACACCTTTGGGGCCCACAGAGG No data
1126257057_1126257062 15 Left 1126257057 15:46640382-46640404 CCTTTCCCTAATGATATCCTGGG No data
Right 1126257062 15:46640420-46640442 ACCTCATTTCCCCACACCTTTGG No data
1126257057_1126257064 16 Left 1126257057 15:46640382-46640404 CCTTTCCCTAATGATATCCTGGG No data
Right 1126257064 15:46640421-46640443 CCTCATTTCCCCACACCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126257057 Original CRISPR CCCAGGATATCATTAGGGAA AGG (reversed) Intergenic
No off target data available for this crispr