ID: 1126257061

View in Genome Browser
Species Human (GRCh38)
Location 15:46640399-46640421
Sequence GTGTGACTAGTCTTGTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126257061_1126257075 25 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257075 15:46640447-46640469 CACAGAGGAAATGAGGGTCTTGG No data
1126257061_1126257065 0 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257065 15:46640422-46640444 CTCATTTCCCCACACCTTTGGGG No data
1126257061_1126257071 18 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257071 15:46640440-46640462 TGGGGCCCACAGAGGAAATGAGG No data
1126257061_1126257069 10 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257069 15:46640432-46640454 CACACCTTTGGGGCCCACAGAGG No data
1126257061_1126257062 -2 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257062 15:46640420-46640442 ACCTCATTTCCCCACACCTTTGG No data
1126257061_1126257072 19 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257072 15:46640441-46640463 GGGGCCCACAGAGGAAATGAGGG No data
1126257061_1126257064 -1 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257064 15:46640421-46640443 CCTCATTTCCCCACACCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126257061 Original CRISPR GTGTGACTAGTCTTGTTCCC AGG (reversed) Intergenic
No off target data available for this crispr