ID: 1126257065

View in Genome Browser
Species Human (GRCh38)
Location 15:46640422-46640444
Sequence CTCATTTCCCCACACCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126257057_1126257065 17 Left 1126257057 15:46640382-46640404 CCTTTCCCTAATGATATCCTGGG No data
Right 1126257065 15:46640422-46640444 CTCATTTCCCCACACCTTTGGGG No data
1126257059_1126257065 12 Left 1126257059 15:46640387-46640409 CCCTAATGATATCCTGGGAACAA No data
Right 1126257065 15:46640422-46640444 CTCATTTCCCCACACCTTTGGGG No data
1126257061_1126257065 0 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257065 15:46640422-46640444 CTCATTTCCCCACACCTTTGGGG No data
1126257055_1126257065 18 Left 1126257055 15:46640381-46640403 CCCTTTCCCTAATGATATCCTGG No data
Right 1126257065 15:46640422-46640444 CTCATTTCCCCACACCTTTGGGG No data
1126257060_1126257065 11 Left 1126257060 15:46640388-46640410 CCTAATGATATCCTGGGAACAAG No data
Right 1126257065 15:46640422-46640444 CTCATTTCCCCACACCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126257065 Original CRISPR CTCATTTCCCCACACCTTTG GGG Intergenic
No off target data available for this crispr