ID: 1126257069

View in Genome Browser
Species Human (GRCh38)
Location 15:46640432-46640454
Sequence CACACCTTTGGGGCCCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126257057_1126257069 27 Left 1126257057 15:46640382-46640404 CCTTTCCCTAATGATATCCTGGG No data
Right 1126257069 15:46640432-46640454 CACACCTTTGGGGCCCACAGAGG No data
1126257060_1126257069 21 Left 1126257060 15:46640388-46640410 CCTAATGATATCCTGGGAACAAG No data
Right 1126257069 15:46640432-46640454 CACACCTTTGGGGCCCACAGAGG No data
1126257061_1126257069 10 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257069 15:46640432-46640454 CACACCTTTGGGGCCCACAGAGG No data
1126257055_1126257069 28 Left 1126257055 15:46640381-46640403 CCCTTTCCCTAATGATATCCTGG No data
Right 1126257069 15:46640432-46640454 CACACCTTTGGGGCCCACAGAGG No data
1126257059_1126257069 22 Left 1126257059 15:46640387-46640409 CCCTAATGATATCCTGGGAACAA No data
Right 1126257069 15:46640432-46640454 CACACCTTTGGGGCCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126257069 Original CRISPR CACACCTTTGGGGCCCACAG AGG Intergenic
No off target data available for this crispr