ID: 1126257071

View in Genome Browser
Species Human (GRCh38)
Location 15:46640440-46640462
Sequence TGGGGCCCACAGAGGAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126257061_1126257071 18 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257071 15:46640440-46640462 TGGGGCCCACAGAGGAAATGAGG No data
1126257059_1126257071 30 Left 1126257059 15:46640387-46640409 CCCTAATGATATCCTGGGAACAA No data
Right 1126257071 15:46640440-46640462 TGGGGCCCACAGAGGAAATGAGG No data
1126257060_1126257071 29 Left 1126257060 15:46640388-46640410 CCTAATGATATCCTGGGAACAAG No data
Right 1126257071 15:46640440-46640462 TGGGGCCCACAGAGGAAATGAGG No data
1126257063_1126257071 -4 Left 1126257063 15:46640421-46640443 CCTCATTTCCCCACACCTTTGGG No data
Right 1126257071 15:46640440-46640462 TGGGGCCCACAGAGGAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126257071 Original CRISPR TGGGGCCCACAGAGGAAATG AGG Intergenic
No off target data available for this crispr