ID: 1126257075

View in Genome Browser
Species Human (GRCh38)
Location 15:46640447-46640469
Sequence CACAGAGGAAATGAGGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126257066_1126257075 -5 Left 1126257066 15:46640429-46640451 CCCCACACCTTTGGGGCCCACAG No data
Right 1126257075 15:46640447-46640469 CACAGAGGAAATGAGGGTCTTGG No data
1126257068_1126257075 -7 Left 1126257068 15:46640431-46640453 CCACACCTTTGGGGCCCACAGAG No data
Right 1126257075 15:46640447-46640469 CACAGAGGAAATGAGGGTCTTGG No data
1126257061_1126257075 25 Left 1126257061 15:46640399-46640421 CCTGGGAACAAGACTAGTCACAC No data
Right 1126257075 15:46640447-46640469 CACAGAGGAAATGAGGGTCTTGG No data
1126257067_1126257075 -6 Left 1126257067 15:46640430-46640452 CCCACACCTTTGGGGCCCACAGA No data
Right 1126257075 15:46640447-46640469 CACAGAGGAAATGAGGGTCTTGG No data
1126257063_1126257075 3 Left 1126257063 15:46640421-46640443 CCTCATTTCCCCACACCTTTGGG No data
Right 1126257075 15:46640447-46640469 CACAGAGGAAATGAGGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126257075 Original CRISPR CACAGAGGAAATGAGGGTCT TGG Intergenic
No off target data available for this crispr