ID: 1126258165

View in Genome Browser
Species Human (GRCh38)
Location 15:46652940-46652962
Sequence CCAGAAAAATCAATTATGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126258165_1126258169 21 Left 1126258165 15:46652940-46652962 CCTAGCATAATTGATTTTTCTGG No data
Right 1126258169 15:46652984-46653006 TCCTTTCAAAGTTGAGTTGTGGG No data
1126258165_1126258168 20 Left 1126258165 15:46652940-46652962 CCTAGCATAATTGATTTTTCTGG No data
Right 1126258168 15:46652983-46653005 GTCCTTTCAAAGTTGAGTTGTGG No data
1126258165_1126258171 22 Left 1126258165 15:46652940-46652962 CCTAGCATAATTGATTTTTCTGG No data
Right 1126258171 15:46652985-46653007 CCTTTCAAAGTTGAGTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126258165 Original CRISPR CCAGAAAAATCAATTATGCT AGG (reversed) Intergenic
No off target data available for this crispr