ID: 1126258171

View in Genome Browser
Species Human (GRCh38)
Location 15:46652985-46653007
Sequence CCTTTCAAAGTTGAGTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126258165_1126258171 22 Left 1126258165 15:46652940-46652962 CCTAGCATAATTGATTTTTCTGG No data
Right 1126258171 15:46652985-46653007 CCTTTCAAAGTTGAGTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126258171 Original CRISPR CCTTTCAAAGTTGAGTTGTG GGG Intergenic
No off target data available for this crispr