ID: 1126261366

View in Genome Browser
Species Human (GRCh38)
Location 15:46696639-46696661
Sequence TAGAGTGACCAGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126261366_1126261369 -5 Left 1126261366 15:46696639-46696661 CCCTCTTCTCTCTGGTCACTCTA No data
Right 1126261369 15:46696657-46696679 CTCTATTTGTTTATGAGTGTGGG No data
1126261366_1126261368 -6 Left 1126261366 15:46696639-46696661 CCCTCTTCTCTCTGGTCACTCTA No data
Right 1126261368 15:46696656-46696678 ACTCTATTTGTTTATGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126261366 Original CRISPR TAGAGTGACCAGAGAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr