ID: 1126269068

View in Genome Browser
Species Human (GRCh38)
Location 15:46791523-46791545
Sequence AGTCACCTTTCTTGATCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126269068_1126269074 17 Left 1126269068 15:46791523-46791545 CCAATAGATCAAGAAAGGTGACT No data
Right 1126269074 15:46791563-46791585 TCAGGAAAATCGTGAGGAGGAGG No data
1126269068_1126269076 26 Left 1126269068 15:46791523-46791545 CCAATAGATCAAGAAAGGTGACT No data
Right 1126269076 15:46791572-46791594 TCGTGAGGAGGAGGGATCTTAGG No data
1126269068_1126269071 -1 Left 1126269068 15:46791523-46791545 CCAATAGATCAAGAAAGGTGACT No data
Right 1126269071 15:46791545-46791567 TCAGGGAGCTGAAAAATGTCAGG No data
1126269068_1126269072 11 Left 1126269068 15:46791523-46791545 CCAATAGATCAAGAAAGGTGACT No data
Right 1126269072 15:46791557-46791579 AAAATGTCAGGAAAATCGTGAGG No data
1126269068_1126269073 14 Left 1126269068 15:46791523-46791545 CCAATAGATCAAGAAAGGTGACT No data
Right 1126269073 15:46791560-46791582 ATGTCAGGAAAATCGTGAGGAGG No data
1126269068_1126269075 18 Left 1126269068 15:46791523-46791545 CCAATAGATCAAGAAAGGTGACT No data
Right 1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG No data
1126269068_1126269077 27 Left 1126269068 15:46791523-46791545 CCAATAGATCAAGAAAGGTGACT No data
Right 1126269077 15:46791573-46791595 CGTGAGGAGGAGGGATCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126269068 Original CRISPR AGTCACCTTTCTTGATCTAT TGG (reversed) Intergenic
No off target data available for this crispr