ID: 1126269075

View in Genome Browser
Species Human (GRCh38)
Location 15:46791564-46791586
Sequence CAGGAAAATCGTGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126269068_1126269075 18 Left 1126269068 15:46791523-46791545 CCAATAGATCAAGAAAGGTGACT No data
Right 1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126269075 Original CRISPR CAGGAAAATCGTGAGGAGGA GGG Intergenic
No off target data available for this crispr