ID: 1126283611

View in Genome Browser
Species Human (GRCh38)
Location 15:46986288-46986310
Sequence AACAACTCTTGGCCTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126283607_1126283611 15 Left 1126283607 15:46986250-46986272 CCTGCCATCTTCTGCAGACAACT 0: 3
1: 193
2: 193
3: 120
4: 281
Right 1126283611 15:46986288-46986310 AACAACTCTTGGCCTGTTATTGG No data
1126283608_1126283611 11 Left 1126283608 15:46986254-46986276 CCATCTTCTGCAGACAACTACTC 0: 3
1: 184
2: 192
3: 126
4: 286
Right 1126283611 15:46986288-46986310 AACAACTCTTGGCCTGTTATTGG No data
1126283606_1126283611 16 Left 1126283606 15:46986249-46986271 CCCTGCCATCTTCTGCAGACAAC 0: 3
1: 188
2: 176
3: 138
4: 305
Right 1126283611 15:46986288-46986310 AACAACTCTTGGCCTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126283611 Original CRISPR AACAACTCTTGGCCTGTTAT TGG Intergenic
No off target data available for this crispr