ID: 1126286666

View in Genome Browser
Species Human (GRCh38)
Location 15:47020244-47020266
Sequence CATATTTGATAGTGTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126286666_1126286668 23 Left 1126286666 15:47020244-47020266 CCTGTGAAACACTATCAAATATG No data
Right 1126286668 15:47020290-47020312 CAGATGGAGAAAAAAAGAAAAGG No data
1126286666_1126286669 24 Left 1126286666 15:47020244-47020266 CCTGTGAAACACTATCAAATATG No data
Right 1126286669 15:47020291-47020313 AGATGGAGAAAAAAAGAAAAGGG No data
1126286666_1126286667 7 Left 1126286666 15:47020244-47020266 CCTGTGAAACACTATCAAATATG No data
Right 1126286667 15:47020274-47020296 ATGAATTATGAGAAGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126286666 Original CRISPR CATATTTGATAGTGTTTCAC AGG (reversed) Intergenic
No off target data available for this crispr