ID: 1126286667

View in Genome Browser
Species Human (GRCh38)
Location 15:47020274-47020296
Sequence ATGAATTATGAGAAGTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126286666_1126286667 7 Left 1126286666 15:47020244-47020266 CCTGTGAAACACTATCAAATATG No data
Right 1126286667 15:47020274-47020296 ATGAATTATGAGAAGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126286667 Original CRISPR ATGAATTATGAGAAGTCAGA TGG Intergenic
No off target data available for this crispr