ID: 1126286669

View in Genome Browser
Species Human (GRCh38)
Location 15:47020291-47020313
Sequence AGATGGAGAAAAAAAGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126286666_1126286669 24 Left 1126286666 15:47020244-47020266 CCTGTGAAACACTATCAAATATG No data
Right 1126286669 15:47020291-47020313 AGATGGAGAAAAAAAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126286669 Original CRISPR AGATGGAGAAAAAAAGAAAA GGG Intergenic
No off target data available for this crispr