ID: 1126289358

View in Genome Browser
Species Human (GRCh38)
Location 15:47056223-47056245
Sequence CTGTTTACAGAGATGTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126289356_1126289358 0 Left 1126289356 15:47056200-47056222 CCACTGTCAAGAACCTAAAGAGT No data
Right 1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG No data
1126289355_1126289358 13 Left 1126289355 15:47056187-47056209 CCTCTCAGAGTTTCCACTGTCAA No data
Right 1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126289358 Original CRISPR CTGTTTACAGAGATGTAGCT AGG Intergenic
No off target data available for this crispr