ID: 1126292348

View in Genome Browser
Species Human (GRCh38)
Location 15:47096295-47096317
Sequence CTGTGGAATAGAAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126292342_1126292348 12 Left 1126292342 15:47096260-47096282 CCACCTTGTATTTTAAGAGGAAC No data
Right 1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG No data
1126292343_1126292348 9 Left 1126292343 15:47096263-47096285 CCTTGTATTTTAAGAGGAACGTT No data
Right 1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126292348 Original CRISPR CTGTGGAATAGAAAGGTGGA AGG Intergenic
No off target data available for this crispr