ID: 1126293208

View in Genome Browser
Species Human (GRCh38)
Location 15:47105993-47106015
Sequence CTGGAGACATAAATAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126293208_1126293211 5 Left 1126293208 15:47105993-47106015 CCTTCCTCTATTTATGTCTCCAG No data
Right 1126293211 15:47106021-47106043 TTCAACTCATTCTTCAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126293208 Original CRISPR CTGGAGACATAAATAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr