ID: 1126296631

View in Genome Browser
Species Human (GRCh38)
Location 15:47144930-47144952
Sequence CTGTTCTTCTTAAGCACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126296626_1126296631 23 Left 1126296626 15:47144884-47144906 CCTAATAGACATATGCAGAACAT No data
Right 1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG No data
1126296630_1126296631 -5 Left 1126296630 15:47144912-47144934 CCAATAGTAACAGGATATCTGTT No data
Right 1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG No data
1126296629_1126296631 -2 Left 1126296629 15:47144909-47144931 CCTCCAATAGTAACAGGATATCT No data
Right 1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG No data
1126296628_1126296631 -1 Left 1126296628 15:47144908-47144930 CCCTCCAATAGTAACAGGATATC No data
Right 1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126296631 Original CRISPR CTGTTCTTCTTAAGCACACA TGG Intergenic
No off target data available for this crispr