ID: 1126298972

View in Genome Browser
Species Human (GRCh38)
Location 15:47174219-47174241
Sequence TCCTTCCCCAGCTATATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126298972_1126298975 -7 Left 1126298972 15:47174219-47174241 CCATGCATATAGCTGGGGAAGGA No data
Right 1126298975 15:47174235-47174257 GGAAGGATGTTCCAGGAACTGGG No data
1126298972_1126298976 3 Left 1126298972 15:47174219-47174241 CCATGCATATAGCTGGGGAAGGA No data
Right 1126298976 15:47174245-47174267 TCCAGGAACTGGGATCAGCAAGG No data
1126298972_1126298978 25 Left 1126298972 15:47174219-47174241 CCATGCATATAGCTGGGGAAGGA No data
Right 1126298978 15:47174267-47174289 GAAAAAACTCTTTTTTTAGACGG No data
1126298972_1126298974 -8 Left 1126298972 15:47174219-47174241 CCATGCATATAGCTGGGGAAGGA No data
Right 1126298974 15:47174234-47174256 GGGAAGGATGTTCCAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126298972 Original CRISPR TCCTTCCCCAGCTATATGCA TGG (reversed) Intergenic
No off target data available for this crispr