ID: 1126299995

View in Genome Browser
Species Human (GRCh38)
Location 15:47184594-47184616
Sequence GCGCACGGGAACCGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126299995_1126300008 9 Left 1126299995 15:47184594-47184616 CCCGCCGCCCGGTTCCCGTGCGC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1126300008 15:47184626-47184648 CGAGGCGGCGGCAGAGTTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1126299995_1126300002 -9 Left 1126299995 15:47184594-47184616 CCCGCCGCCCGGTTCCCGTGCGC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1126300002 15:47184608-47184630 CCCGTGCGCAGCATGGCCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
1126299995_1126300005 -3 Left 1126299995 15:47184594-47184616 CCCGCCGCCCGGTTCCCGTGCGC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1126300005 15:47184614-47184636 CGCAGCATGGCCCGAGGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 150
1126299995_1126300004 -6 Left 1126299995 15:47184594-47184616 CCCGCCGCCCGGTTCCCGTGCGC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1126300004 15:47184611-47184633 GTGCGCAGCATGGCCCGAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126299995 Original CRISPR GCGCACGGGAACCGGGCGGC GGG (reversed) Intronic