ID: 1126299995

View in Genome Browser
Species Human (GRCh38)
Location 15:47184594-47184616
Sequence GCGCACGGGAACCGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126299995_1126300004 -6 Left 1126299995 15:47184594-47184616 CCCGCCGCCCGGTTCCCGTGCGC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1126300004 15:47184611-47184633 GTGCGCAGCATGGCCCGAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1126299995_1126300002 -9 Left 1126299995 15:47184594-47184616 CCCGCCGCCCGGTTCCCGTGCGC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1126300002 15:47184608-47184630 CCCGTGCGCAGCATGGCCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
1126299995_1126300005 -3 Left 1126299995 15:47184594-47184616 CCCGCCGCCCGGTTCCCGTGCGC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1126300005 15:47184614-47184636 CGCAGCATGGCCCGAGGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 150
1126299995_1126300008 9 Left 1126299995 15:47184594-47184616 CCCGCCGCCCGGTTCCCGTGCGC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1126300008 15:47184626-47184648 CGAGGCGGCGGCAGAGTTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126299995 Original CRISPR GCGCACGGGAACCGGGCGGC GGG (reversed) Intronic
900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG + Intronic
902600879 1:17539665-17539687 GCGCCCCGGGACCGGGCGGGCGG + Intergenic
903522214 1:23959522-23959544 GCGCACGAGAGCCGAGCGGTAGG + Intronic
905308427 1:37034211-37034233 GCGCTCGGGAGCCGGGCGGCTGG - Intergenic
912361668 1:109100611-109100633 GGGCACGGCCACCGGGCTGCGGG + Intergenic
913027123 1:114854853-114854875 GCGCGTGGGCCCCGGGCGGCTGG - Exonic
915225003 1:154405562-154405584 GCTAATGGGAACCGGGCGGCAGG - Exonic
915358819 1:155273330-155273352 GAGCCCGGGAACGGGGCGGGAGG - Intronic
916233392 1:162561811-162561833 GGGCTCGGGACCCGGGCGGGCGG + Intronic
922739846 1:228008725-228008747 GCGCTCAGGAACGCGGCGGCGGG - Intronic
922950931 1:229558291-229558313 CCGCCCGGGAACCGGGCGCGCGG + Exonic
1062843785 10:689685-689707 GGGCGCGGGAGGCGGGCGGCGGG + Intronic
1070257644 10:74825561-74825583 GCGCTGCGGACCCGGGCGGCTGG + Intronic
1070672680 10:78388927-78388949 AAGCACGGGAACAGGGGGGCAGG - Intergenic
1076442425 10:130489179-130489201 GCGCACGGGAGCAGGGAAGCTGG + Intergenic
1076698590 10:132258607-132258629 CCGAACAGGAACAGGGCGGCGGG + Intronic
1078091738 11:8268397-8268419 GGGCACCGGCACCGGGCGCCGGG + Intronic
1078246212 11:9574521-9574543 GGGCGCGGGCACCCGGCGGCCGG + Intronic
1082986151 11:59172544-59172566 GCGCTCGGGGCCCGGGAGGCGGG + Exonic
1083171260 11:60925031-60925053 GCGCCCGGGACCGGGGCCGCCGG - Intronic
1083958837 11:66002708-66002730 GCGCGTGGGAGCCGGGCCGCGGG + Intronic
1085474842 11:76783291-76783313 GCGGGCGGGGACCGGGGGGCGGG + Intronic
1091916493 12:4274332-4274354 CCGCACAGGAGCCGGGAGGCCGG - Intronic
1091937278 12:4443893-4443915 GCACACGGGCTCCGGCCGGCAGG + Intronic
1100611396 12:96194346-96194368 GCGCACGGGGCCGGGGCGGCGGG + Intergenic
1102197188 12:111034057-111034079 GCGCTCAGGGCCCGGGCGGCCGG + Exonic
1103595430 12:122022216-122022238 GCGCTCGGGCTCGGGGCGGCCGG - Intronic
1105277685 13:18945036-18945058 GGGCACGGGAACAGGACGCCAGG - Intergenic
1106226330 13:27789816-27789838 GCCCCCGGAAACCAGGCGGCGGG + Intergenic
1106735928 13:32587172-32587194 GCGCGCGGGGACCCGGCGGCGGG - Intronic
1117251835 14:53946793-53946815 GCCCGCGGGAGCCGCGCGGCAGG - Intergenic
1122418334 14:101560834-101560856 GCGCGCGGGAGGCGGGCGGGCGG + Intergenic
1122666682 14:103334721-103334743 GCGCGCGGGGAGGGGGCGGCCGG - Intronic
1122904591 14:104795862-104795884 GCGCTCGGGGAGCGCGCGGCCGG + Intergenic
1124187263 15:27541734-27541756 GCGCAGGGGAGGAGGGCGGCGGG - Exonic
1126299995 15:47184594-47184616 GCGCACGGGAACCGGGCGGCGGG - Intronic
1126668447 15:51094792-51094814 GCGCGCAGGCACCGGCCGGCGGG - Intronic
1128264312 15:66253707-66253729 GCAGCCGGGAGCCGGGCGGCGGG + Exonic
1129919859 15:79311043-79311065 GCGCACGCGCAGCGGGCGGAAGG + Exonic
1131215200 15:90530244-90530266 GCGGGCGGGACCCGCGCGGCGGG + Intronic
1132368673 15:101277459-101277481 GCGCACCGGAAGCGCCCGGCTGG - Intronic
1132803873 16:1766833-1766855 GCGCGGGGGAACGGGGCGGAGGG + Intronic
1132851595 16:2027243-2027265 GCGCTCGGGGAGGGGGCGGCGGG - Intronic
1133220136 16:4316219-4316241 GCGGTCGGGATCCGGGCTGCGGG - Intronic
1133336256 16:5008530-5008552 GCGCCCGGGAACCGGGGACCAGG + Exonic
1138595202 16:58025999-58026021 GCGCCGCGGGACCGGGCGGCCGG + Exonic
1142156451 16:88534685-88534707 GGCCACGGGACCCGGGCTGCGGG - Exonic
1142812357 17:2401222-2401244 GCGCGCCGGATCCGGGGGGCGGG - Intergenic
1146058606 17:29593248-29593270 GCGCACGGGACGCGGGCCCCGGG - Intronic
1148791929 17:50178115-50178137 GCACACGGGAGCCTGGCTGCCGG + Intergenic
1153851903 18:9102759-9102781 GCGCTCCGGGCCCGGGCGGCTGG + Exonic
1157815910 18:50729471-50729493 TCGCACTGGAAGCAGGCGGCCGG + Exonic
1158859901 18:61581981-61582003 GGGCCCGGGCACCGGGAGGCTGG - Intergenic
1159798169 18:72868035-72868057 GTGCAGGGGAGCGGGGCGGCCGG + Intronic
1160921710 19:1523875-1523897 CCGCACGCCAACCGGGCGCCAGG - Intergenic
1160935607 19:1593059-1593081 GCGCACGCGCACCAGGCGGCCGG - Intergenic
1161733750 19:5978009-5978031 GCGGCCGGGGAACGGGCGGCGGG - Intronic
1162728947 19:12706154-12706176 GGGCACGGGGATCGGGAGGCGGG + Intronic
1163726588 19:18926468-18926490 GCTCACGGGAGCAGGCCGGCTGG - Intronic
1164693164 19:30225844-30225866 GCGAGAAGGAACCGGGCGGCAGG - Intergenic
1168336590 19:55600571-55600593 GCGCCGGGTAAGCGGGCGGCGGG - Intronic
929778833 2:44944505-44944527 GCGCGGGGGAGCCGGGTGGCGGG + Intronic
935301667 2:101698158-101698180 GCGCGCGGGGAGCGGGCAGCCGG + Intronic
936278832 2:111121262-111121284 GTGCACGGGAAGCGGGCAGTAGG - Intronic
937097314 2:119243809-119243831 GGGCAGGGGAACCAGGAGGCTGG - Intronic
937222030 2:120347221-120347243 GGGCACCGGAATCGGGCGGAAGG + Intronic
942232638 2:173874222-173874244 GCGCACGGGAAGCGGGCCTGTGG + Intergenic
946855206 2:223944566-223944588 GCGCACTGGAACCGGGGTCCCGG + Intronic
1169758680 20:9068601-9068623 GCTCGCGGCAACTGGGCGGCCGG + Intergenic
1173803987 20:45912126-45912148 GCTCAGGGGATCCGGGCGACGGG + Intronic
1175889734 20:62310818-62310840 GCGCACGGAGACCTGGGGGCAGG + Exonic
1176015576 20:62929470-62929492 GGGCCCGCGACCCGGGCGGCCGG + Intronic
1176301419 21:5100783-5100805 GCCCATGAGAAGCGGGCGGCGGG + Intergenic
1177431732 21:20998424-20998446 GCGCGCGGGCTGCGGGCGGCTGG + Exonic
1179810417 21:43865800-43865822 GCGCCCCGAAACCAGGCGGCGGG - Intronic
1179855612 21:44161116-44161138 GCCCATGAGAAGCGGGCGGCGGG - Intergenic
1181272247 22:21665974-21665996 GCGCCCCGGAAACGGGCGCCTGG - Intronic
1183942280 22:41302358-41302380 GCCCGCGGGAAGGGGGCGGCAGG + Intronic
961536725 3:127575347-127575369 GGGCATGGGAAGTGGGCGGCAGG - Intronic
968641515 4:1717264-1717286 GCGCAGGGGGTCCTGGCGGCTGG + Exonic
968756600 4:2419142-2419164 GCGAGAGGGAACCGGCCGGCAGG - Intronic
969667926 4:8572765-8572787 GCTCACGGGAACTGGGCAGGTGG + Intronic
971405631 4:26319490-26319512 GTGCCCGGGAGGCGGGCGGCGGG - Intronic
973137333 4:46724487-46724509 GCGCGCGGCTTCCGGGCGGCGGG + Intergenic
984146344 4:176065936-176065958 GCGCCCGGGGGCGGGGCGGCCGG - Intronic
985638810 5:1053496-1053518 GGGCACGGTCAGCGGGCGGCGGG + Intronic
997305043 5:132830554-132830576 GGGAGCGGGAAGCGGGCGGCTGG - Intronic
1002001526 5:176199065-176199087 GCGCACTGGTGGCGGGCGGCGGG - Intergenic
1002252814 5:177939914-177939936 GCGCACTGGTGGCGGGCGGCGGG + Intergenic
1006517994 6:34555369-34555391 GGGCACAGGAACCAGGGGGCTGG - Intronic
1007703011 6:43775247-43775269 GCGCACTGGAAGCAGGGGGCCGG - Intronic
1019529613 7:1496848-1496870 GAGCACGGGAGCAGGGAGGCAGG - Intronic
1019701709 7:2477488-2477510 GAACACGGGGACAGGGCGGCAGG - Intergenic
1020292087 7:6730000-6730022 GGCCAGGGGAACCGGGCGGGAGG + Intergenic
1021992508 7:26152138-26152160 GGGCGCGGGCCCCGGGCGGCAGG + Intergenic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1023038523 7:36153276-36153298 GCGAGCGGGAGCCGTGCGGCTGG + Exonic
1025231009 7:57203343-57203365 GCGCACGGAAGCCCGGCGGAGGG - Intergenic
1043873812 8:85463744-85463766 GCCGAGGGGAGCCGGGCGGCGGG + Intergenic
1049442117 8:142614340-142614362 CCGCACGGGACCCAGGCCGCCGG - Exonic
1051171570 9:14322708-14322730 GCGCCCGGGACCCGGGAGGCGGG + Intronic
1052807532 9:33025727-33025749 GCGCACGCGCACAGGGAGGCAGG + Intronic
1053137117 9:35658281-35658303 GCGCACGCGAGCAGGCCGGCCGG - Intronic
1057604434 9:96489091-96489113 GAGCGAGGGAACCGGGCAGCAGG - Intronic
1057758091 9:97853125-97853147 GCGCCCGGGCCCCGGGGGGCGGG + Intergenic
1062462134 9:136666410-136666432 GGGCACGGGGACCGGACTGCTGG + Intronic
1062659025 9:137618855-137618877 GCGCACTGGAACCAGGCGTGCGG - Intronic
1185610563 X:1391843-1391865 GGGGACGGGAACCGAGTGGCCGG - Intronic
1192118542 X:68433679-68433701 GTGCAAGGGAGCCGGCCGGCCGG + Exonic