ID: 1126306670

View in Genome Browser
Species Human (GRCh38)
Location 15:47266519-47266541
Sequence CATTACGGCTTATAAGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126306670_1126306676 -10 Left 1126306670 15:47266519-47266541 CCACTGCCTTATAAGCCGTAATG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1126306676 15:47266532-47266554 AGCCGTAATGAGGGCAGTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126306670 Original CRISPR CATTACGGCTTATAAGGCAG TGG (reversed) Intronic
905318353 1:37097718-37097740 CATTACGGCTGCTAGGGCCGGGG - Intergenic
905478590 1:38245992-38246014 AATAATGGCTTATATGGCAGGGG + Intergenic
917537696 1:175886339-175886361 CATTAAGGCTTATTTTGCAGGGG + Intergenic
1072999428 10:100276095-100276117 CCTTACCGCGTAGAAGGCAGGGG - Intronic
1074829298 10:117237550-117237572 CATGAGGGTTTATAAGGGAGGGG + Intergenic
1076250094 10:128978534-128978556 CATTAAGTCTTATAAGAGAGAGG - Intergenic
1087724957 11:101706141-101706163 CACTATGACTTCTAAGGCAGGGG + Intronic
1088181919 11:107122040-107122062 CATCACTGCTAATCAGGCAGGGG + Intergenic
1097734655 12:63168273-63168295 CATTGGGGCTTATCAGACAGTGG - Intergenic
1103859221 12:123998639-123998661 CATTACAGCTGATGAGCCAGGGG - Intronic
1109688506 13:65852904-65852926 CGTTAGTGCTTATAAGTCAGAGG - Intergenic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1126306670 15:47266519-47266541 CATTACGGCTTATAAGGCAGTGG - Intronic
1150066488 17:62113995-62114017 CATGATGTCTTATAGGGCAGTGG - Intergenic
1159786269 18:72718234-72718256 AGTAACGGCTTATAAGTCAGAGG + Intergenic
1159925940 18:74269151-74269173 CATTACTGTTTACAATGCAGGGG - Intronic
1162107797 19:8381046-8381068 CATTACGGGTTCTTGGGCAGGGG + Intronic
933572421 2:84029081-84029103 CTTTAAGGATTATTAGGCAGTGG - Intergenic
936167204 2:110131642-110131664 CATTACTGCACATAAGGAAGTGG + Intronic
942179457 2:173366378-173366400 CATAACGGTTTCGAAGGCAGGGG - Exonic
946748642 2:222870917-222870939 AAATACGGGTTATAAGGGAGTGG + Intronic
1175157947 20:56985898-56985920 CATCCCTGCTTGTAAGGCAGAGG + Intergenic
1181595761 22:23913559-23913581 CATTATGGTTTATAGGGCTGGGG + Intergenic
953996647 3:47524838-47524860 AATTCTGGCTCATAAGGCAGAGG + Intergenic
955887625 3:63617806-63617828 CATGACAGCTTATAAAGCAGAGG - Intergenic
959944083 3:112109451-112109473 CAAAACTGCTTCTAAGGCAGAGG - Intronic
963129393 3:141844319-141844341 CATTCCAGTTTAAAAGGCAGAGG - Intergenic
963268771 3:143265603-143265625 CTTTATGGCTTAAAAGGCACAGG + Exonic
965669107 3:171128266-171128288 AATTACGTCTTCTAAGCCAGTGG - Intronic
967704288 3:192631717-192631739 TATTTCTGCATATAAGGCAGTGG + Intronic
973885196 4:55313918-55313940 CATCACAGCTCCTAAGGCAGGGG + Intergenic
973928338 4:55763034-55763056 CATCAAGATTTATAAGGCAGAGG + Intergenic
984795125 4:183653029-183653051 CTTTTTGGCTTAAAAGGCAGGGG - Intronic
984934426 4:184877932-184877954 CTTCACAGTTTATAAGGCAGGGG + Intergenic
986932383 5:12842354-12842376 CAGTACTGCTTAGAAGTCAGTGG + Intergenic
995180652 5:109227611-109227633 CATTATTGATTATAAGGCAAAGG + Intergenic
996278492 5:121697569-121697591 CATTATGACTTTTGAGGCAGGGG - Intergenic
1001495284 5:172183903-172183925 CATTAAGGCTTATCAGGGAGAGG + Intronic
1009211422 6:60867812-60867834 CATAACTGATTGTAAGGCAGAGG - Intergenic
1013170112 6:107629334-107629356 GATTACTGCTCAGAAGGCAGTGG + Intronic
1017147172 6:151244893-151244915 CATTACAGCTTATAGGCTAGTGG + Intronic
1021756861 7:23860409-23860431 CATTGCGGGTTCTTAGGCAGGGG - Intergenic
1023365614 7:39460463-39460485 TATTACGGTTTATAAGAAAGTGG - Intronic
1029342889 7:99959020-99959042 CATTACTCCTTATATGGCAGAGG + Intergenic
1033520647 7:142157187-142157209 CAATGTGGCTTATAAGGCAATGG + Intronic
1035842545 8:2828045-2828067 CATTTCAGCTTTTAAGGCAGGGG + Intergenic
1037212546 8:16408925-16408947 CATTACTGCTTAAAGGGCATGGG + Intronic
1056679986 9:88708735-88708757 CATTAGGGCTTATTAGGAGGTGG + Intergenic
1057712831 9:97462738-97462760 CATTACAGCTTGTATGACAGTGG - Intronic
1058617824 9:106852590-106852612 CATAACCCCTTATCAGGCAGAGG - Intergenic
1058800756 9:108542619-108542641 CATTACAGATAATAAGCCAGGGG - Intergenic
1193592464 X:83407245-83407267 CACTGGGGCTTATCAGGCAGTGG + Intergenic
1198347553 X:135773633-135773655 CATTACTGCTTAGAAGATAGAGG - Intergenic
1198349458 X:135790894-135790916 CATTACTGCTTAGAAGATAGAGG - Intergenic
1198351363 X:135808167-135808189 CATTACTGCTTAGAAGATAGAGG - Intergenic
1198353272 X:135825433-135825455 CATTACTGCTTAGAAGATAGAGG - Intergenic
1198355179 X:135842687-135842709 CATTACTGCTTAGAAGATAGAGG - Intergenic
1198357089 X:135859970-135859992 CATTACTGCTTAGAAGATAGAGG - Intergenic
1198359003 X:135877249-135877271 CATTACTGCTTAGAAGATAGAGG - Intergenic
1198365473 X:135935480-135935502 CATTACTGCTTAGAAGATAGAGG - Intergenic
1201388127 Y:13465795-13465817 CATTAAGGCTTATAATGCCAGGG - Intronic
1202067734 Y:20958405-20958427 CTATATGGCTTATAAAGCAGAGG - Intergenic