ID: 1126309623

View in Genome Browser
Species Human (GRCh38)
Location 15:47300902-47300924
Sequence AGTCCTCTGCAGGTGGTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126309623_1126309628 25 Left 1126309623 15:47300902-47300924 CCCTAAACCACCTGCAGAGGACT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1126309628 15:47300950-47300972 ATAATTTTAATACTAAATTCTGG 0: 1
1: 0
2: 4
3: 62
4: 756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126309623 Original CRISPR AGTCCTCTGCAGGTGGTTTA GGG (reversed) Intronic
901826316 1:11863985-11864007 GGCCCTATGCAGGTGGTTTCTGG - Intergenic
902336558 1:15757997-15758019 AGCCCTCTGCAGGTGGGTCCCGG - Intronic
904342848 1:29848911-29848933 AGGCCTCTGCAGTTTGCTTAAGG + Intergenic
905325121 1:37146406-37146428 AGTCCTCCTCAGGTGGTTCTTGG - Intergenic
905746793 1:40425019-40425041 TTTCCTATGCAGGTGGATTATGG + Intergenic
906059070 1:42936568-42936590 AGCCCTCTGCAGGGGGGTTGGGG - Intronic
906697419 1:47832586-47832608 AGTCTTCTGCAGGTGCTGAAGGG + Intronic
909226786 1:73034780-73034802 AGGCTGCTGCAGGTGGTATATGG - Intergenic
913366010 1:118039666-118039688 AGTACTCGGCAGGTAGTTTTTGG - Intronic
913507331 1:119529236-119529258 AGTCCTCAGCTGGTGATTTCAGG - Intergenic
917936332 1:179870814-179870836 AGTCCTAAGCAGCTGATTTAAGG + Intronic
918078312 1:181187375-181187397 AGTTCACTGCATGGGGTTTATGG - Intergenic
921412495 1:214850600-214850622 TGCCCTTTGCTGGTGGTTTAAGG + Intergenic
923792176 1:237121086-237121108 AGACCACTGTAGGTGGTTTCAGG + Intronic
924569528 1:245225638-245225660 AGTCCTGTGCAGGTGGCTGGAGG + Intronic
1064102251 10:12473866-12473888 AGTCCTCTGCAGTTTTTGTAGGG + Intronic
1064890701 10:20169497-20169519 AGACCTCTGCATGTTGTGTAAGG - Intronic
1065228198 10:23569091-23569113 ACTCCCCTGCATGTGCTTTATGG + Intergenic
1067335203 10:45356029-45356051 ACTACTCTGCAGGTGGTTTTGGG - Intergenic
1067737809 10:48872102-48872124 AGTGCCCAGCAGGTGGTTTCTGG - Intronic
1070658189 10:78285622-78285644 ATTCCTCTGCAGGTGTATGATGG - Intergenic
1070839447 10:79473433-79473455 ACTCATCTGAAGGTGGTTTAGGG + Intergenic
1071434211 10:85631926-85631948 AGTCCTCTTCCTGTGCTTTATGG - Intronic
1075010599 10:118866455-118866477 AGTCCTTTGCAGCTGGTCTCCGG + Intergenic
1077060791 11:617088-617110 CGGGCACTGCAGGTGGTTTACGG + Exonic
1081007052 11:37757558-37757580 AGAAATCTGCAGGTGGTTCAAGG - Intergenic
1083566226 11:63719132-63719154 AGTACTCAGTAGGTGGTTTCTGG - Exonic
1083876496 11:65526730-65526752 AGGCCTGTGCAGGTGGTTGGTGG + Intronic
1085781737 11:79415357-79415379 ATTCGTTTACAGGTGGTTTAGGG + Intronic
1088280897 11:108133579-108133601 AGTTCTCTACAGGAGGTTTGAGG - Intronic
1088750996 11:112842028-112842050 AGACCTTTGGAGGTGGCTTACGG + Intergenic
1096173218 12:49491204-49491226 AGTCCTCTCCGTGTGATTTAAGG + Intronic
1098847866 12:75560443-75560465 TGTGCTCTGCACGTGGGTTAGGG - Intergenic
1100931984 12:99619739-99619761 AGTTCTCTGCAGGGGGATGAGGG - Intronic
1102195353 12:111021501-111021523 AGTCCTCAGCAGGTGTTTCTGGG + Intergenic
1104632174 12:130412906-130412928 TGACCTATGCAGGTGATTTATGG - Intronic
1110987298 13:81986554-81986576 ATTCCTCTACAGGTGGTGGAGGG + Intergenic
1112746696 13:102534992-102535014 CATCCTCTGCAGGTGGATGAAGG + Intergenic
1114143097 14:19939656-19939678 AGTACTCAACAGGTGGTTTTTGG - Intergenic
1117647477 14:57866513-57866535 AGTTCCCGGCAGGTGGTATATGG + Intronic
1117978500 14:61320895-61320917 CTTCCTCTGCGGGTGGTTTCTGG - Intronic
1120923152 14:89773086-89773108 AGTACGATGCAGGTGCTTTAGGG + Intergenic
1122396140 14:101433425-101433447 AGTCCTGGGCAGGTAGTTTGTGG - Intergenic
1122896758 14:104761533-104761555 AGTCCTCAGCAGGAGCCTTAGGG - Intronic
1126309623 15:47300902-47300924 AGTCCTCTGCAGGTGGTTTAGGG - Intronic
1126526858 15:49665904-49665926 AGGCCTCTTCAGCTGGTTTCTGG - Intergenic
1126630992 15:50735264-50735286 ACGCCTCTGCATGTGGTATATGG + Intronic
1126858361 15:52860669-52860691 AGTCCACTGTAGTTAGTTTAAGG + Intergenic
1128495064 15:68193106-68193128 AGTCCTGGGGAGGTGGCTTAAGG + Exonic
1128761637 15:70220034-70220056 ATTCCTTTACAGGTGGTCTATGG + Intergenic
1128922912 15:71628574-71628596 ATTCCTCTTCAGGAGGTTTAGGG + Intronic
1131051946 15:89354213-89354235 AGTCCTCTGAAGGAGGTTGCAGG + Intergenic
1131151807 15:90051993-90052015 CTTCCTCTGCAGGTGGTAGAAGG - Intronic
1131302942 15:91215419-91215441 TCTCTCCTGCAGGTGGTTTAAGG + Intronic
1133247183 16:4456808-4456830 CAGCCTCTGCAGGTGGCTTATGG + Intergenic
1138594298 16:58021516-58021538 AGTCCTCTTCAGGTGTCTTCTGG + Exonic
1141080017 16:81042355-81042377 AGTCCTCTGCATGTCTTTTCAGG - Exonic
1143616817 17:8056501-8056523 AGTCCTCTGCAGTAGGGTTAAGG + Intergenic
1143782575 17:9236960-9236982 AGGCCTCTGCAGGAAGTCTAAGG + Intronic
1144271186 17:13617829-13617851 AGTCCATAGAAGGTGGTTTAGGG - Intergenic
1144316574 17:14068095-14068117 ATTTCTGTGCAGTTGGTTTAAGG - Intergenic
1144415275 17:15040636-15040658 AGTTCTCTGCAGCTGCCTTATGG + Intergenic
1145261239 17:21355958-21355980 AGCCCTCTGGAGCTGGCTTAGGG - Intergenic
1148320084 17:46743301-46743323 AGTCCTCTGCCTGTGGTGTCAGG - Intronic
1150577296 17:66441578-66441600 TCTCCTCTTCAGGTGGTTTCTGG + Intronic
1152106259 17:78330934-78330956 AATCCTCTGCAGGTGGCTCTGGG + Intergenic
1155157319 18:23168518-23168540 AGTCGTCTGGAGGTGGATAATGG + Intronic
1156452983 18:37277096-37277118 AGGACTCTGCAGGTGGCTTGTGG - Intronic
1156500233 18:37552839-37552861 TGTCCTCTGCAGCTGGTGTGTGG + Intronic
1157049329 18:44142681-44142703 ATTCCTCTGCAGCTGGTATACGG - Intergenic
1162541661 19:11300239-11300261 TGTCCCCTGCAGGTGTTTTCTGG - Intronic
1164586812 19:29480847-29480869 AGTGCTCTGCAGGTGTTTATGGG - Intergenic
1167518493 19:49937958-49937980 AGACCCCTGCAGGGGGTTTTAGG + Intronic
925803019 2:7620152-7620174 ATTCCTCTGTAGGTAATTTATGG + Intergenic
926765318 2:16318714-16318736 AGTCCTCTGAGGGGGGTCTATGG + Intergenic
928049248 2:27972246-27972268 AGTCATCTGCAGATGGTTTGGGG + Intronic
928424186 2:31164522-31164544 AGTTCTCCACAGGTGGTTTTTGG + Intergenic
929868656 2:45739456-45739478 AGTCCTCTGCAGGCTGTAAAAGG - Intronic
931071065 2:58650810-58650832 AGTTCTCTCCAGGTCATTTAAGG + Intergenic
932697017 2:73965418-73965440 AATCCTGTGAAGGAGGTTTAAGG + Intergenic
936861146 2:117022039-117022061 AGTGCTCTGCTCTTGGTTTATGG - Intergenic
940769142 2:157821732-157821754 ATTCCTGTGCAGGTGGTTGGAGG + Intronic
941114194 2:161452665-161452687 ATTCCTCTGCAGGTTCTCTATGG + Intronic
942812327 2:180013789-180013811 AGCCCACTGCAGGTGGCATATGG - Intergenic
944909850 2:204299838-204299860 AATCATCTGCGGGTGGTGTAGGG - Intergenic
945929033 2:215836373-215836395 AGTTCTCTGGAGCTGATTTAGGG - Intergenic
947172572 2:227325649-227325671 CGTCTTCTGCAGGTGTTTTTGGG + Intronic
947644611 2:231729289-231729311 ACTCCGATGCAGGTGGTCTATGG - Intergenic
948068876 2:235103756-235103778 ATTCCGATGCAGGTGGTCTATGG - Intergenic
1169957343 20:11119268-11119290 AGTCCTCTGCAGATTCTTCAAGG - Intergenic
1170541576 20:17394356-17394378 AGTTCTCTCCAAGTGGTTCAAGG - Intronic
1175943370 20:62547990-62548012 TGGTGTCTGCAGGTGGTTTAAGG - Intergenic
1179577398 21:42316729-42316751 AGTCCACTGCAGGAGGTTGGGGG - Intergenic
1180229004 21:46414981-46415003 AGTGCTGGGCAGGTGTTTTATGG + Intronic
1183741461 22:39670786-39670808 GGGCCTCTGCAGGTGGTGCAGGG - Exonic
950143645 3:10632726-10632748 GGTCCTCTGCAGGTGGCTCTGGG + Intronic
951436011 3:22665691-22665713 AGGGCCCTGCACGTGGTTTATGG + Intergenic
952156320 3:30647397-30647419 AGTTCTGTGCAGGAGGTTTTTGG - Intronic
956399217 3:68859014-68859036 AGTCCTCTGCAGCTGGCTTCTGG - Intronic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
959494553 3:107035066-107035088 AGTCCTCAGAAGTTCGTTTAGGG + Intergenic
960659645 3:120043757-120043779 AGTGCTCTGAAGGGGGTGTAGGG - Intronic
961792126 3:129383821-129383843 TGTCCTCTCAAGGTGTTTTAAGG + Intergenic
965528696 3:169748907-169748929 CATCCTCTGTAGGTGGTTTAAGG + Intergenic
970407506 4:15778137-15778159 AATCCTCTGCAGGTGTCCTAAGG - Intergenic
970947194 4:21708595-21708617 AGTGGTCTGCAGGTGGCTTTAGG - Intronic
972371405 4:38427010-38427032 AGTCATCTGGAAGTGATTTATGG - Intergenic
975808433 4:78138082-78138104 TTTCTTCTGCAGGTGGTTTCAGG + Intronic
977719863 4:100226998-100227020 AGTCTTTTCCAGGTGGTTTTGGG - Intergenic
979553920 4:122022952-122022974 AGTCTTCTGCAGGAGGCTTTAGG - Intergenic
980343946 4:131587464-131587486 AGTCCTGTGGATGTGGTTTTGGG + Intergenic
980533194 4:134081281-134081303 ATTCCTCTGCAGCTGCTTTCGGG - Intergenic
981400320 4:144306346-144306368 AGTCTTCTGCAAGTGGATCAGGG - Intergenic
985534793 5:458022-458044 AGTCCCCTGCAGGTGGTACCTGG - Exonic
989448727 5:41562182-41562204 AGTCGTCTGGATGAGGTTTAGGG - Intergenic
990637027 5:57739894-57739916 AGTACTCTGCAGGTGGAGCATGG + Intergenic
996949108 5:129103784-129103806 AGTTATCTGTAGGTGGTTTTAGG + Intronic
1003734526 6:8863685-8863707 GGTCCTCTGCAGGTTGTCCAAGG - Intergenic
1006832230 6:36975960-36975982 AGTCCTCTACTGGTGTTTTCTGG + Intronic
1018834732 6:167474348-167474370 TGTCGTCTGCAGGTGACTTACGG + Intergenic
1027516897 7:79153584-79153606 ATTCCTCTGAAGGTGAGTTACGG + Intronic
1033433667 7:141312745-141312767 AATCCTCTGCTGGTGGTCCATGG + Intronic
1033601840 7:142894123-142894145 AGTCCCCTGGAGGTGGAGTAGGG + Intergenic
1038287175 8:26215701-26215723 AGTACTCTGCAGCTGATTGAAGG + Intergenic
1045064933 8:98436308-98436330 GGTCCTTTGCAGGTGGGTTGAGG - Intronic
1049676307 8:143890803-143890825 AGTCCACTGCAGTTGGTTTGGGG + Intergenic
1050084449 9:1950043-1950065 AGTCCTCTGCCAGGGATTTAAGG + Intergenic
1054238355 9:62584451-62584473 AGTCATCTGCAGGTTGATTTGGG - Intergenic
1055306640 9:74936218-74936240 ATTCATCTGCAAGGGGTTTATGG + Intergenic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1057463850 9:95292871-95292893 AGTCCTCTGCAAGTCTTTTCAGG - Intronic
1059040866 9:110814195-110814217 ATTCCTGTGCAAGTGGTTTATGG + Intergenic
1061938537 9:133871892-133871914 AGCCCCCAGCAGGTGGTTCAGGG + Intronic
1186643225 X:11479590-11479612 AGGGCTCTGCACTTGGTTTAAGG + Intronic
1189130114 X:38489859-38489881 ATTCCTGTGCAAGTGATTTATGG + Intronic
1199393119 X:147305117-147305139 AATCCTTGGGAGGTGGTTTATGG - Intergenic