ID: 1126310051

View in Genome Browser
Species Human (GRCh38)
Location 15:47305314-47305336
Sequence GTGATCACCAGGTCATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126310051_1126310054 10 Left 1126310051 15:47305314-47305336 CCATGGGATGACCTGGTGATCAC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1126310054 15:47305347-47305369 GGAATATCTATAGAGCAATGTGG 0: 1
1: 0
2: 0
3: 23
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126310051 Original CRISPR GTGATCACCAGGTCATCCCA TGG (reversed) Intronic
900493834 1:2967208-2967230 GGGAGCGCCAGGTCCTCCCAGGG - Intergenic
900559006 1:3294476-3294498 CAGATCACCAGGTAAACCCATGG + Intronic
900560503 1:3303587-3303609 GGCATTACCAGGTCATCCAATGG + Intronic
900927215 1:5713202-5713224 GTGATCACCAGGCCAGCACCTGG + Intergenic
901204111 1:7484141-7484163 GCCATCACCAGCTCATCCCAGGG + Intronic
902341690 1:15787484-15787506 GTGCTCACCAAGTGAGCCCAGGG - Intergenic
904268291 1:29330735-29330757 GTGATCACCAGGACCAGCCAGGG - Intergenic
904428934 1:30449526-30449548 GTGATCACCAGGACCAGCCAGGG + Intergenic
907696143 1:56731176-56731198 GTGCTCACCAAGTGAGCCCAGGG - Intronic
915274669 1:154779957-154779979 GTCATCACCAGCTCACCACAAGG + Intronic
917648876 1:177056342-177056364 GGGATCTCCAGGTGAACCCAAGG - Intronic
921054258 1:211532171-211532193 GAGATCCCTGGGTCATCCCAAGG - Intergenic
921326868 1:213994124-213994146 ATGAGCACAAGGTCATCCCCAGG - Intronic
921338492 1:214111380-214111402 GAGAGCACCTGGGCATCCCAAGG + Intergenic
923492772 1:234499122-234499144 GTGATCACCAGGGCCCCCAAAGG - Intergenic
924101354 1:240605754-240605776 GTTATGAACAGGCCATCCCAGGG + Intronic
1066289718 10:34002698-34002720 GTGATCACCACATCATGCAATGG + Intergenic
1070656422 10:78274712-78274734 GTGCTCTCCACGTCACCCCAGGG - Intergenic
1072456928 10:95584624-95584646 GTGAACTCCTGGTTATCCCAGGG - Intergenic
1073467591 10:103703214-103703236 GCGATCACCCGGGCCTCCCAGGG - Intronic
1074164722 10:110865086-110865108 GTCCTCACCAGGTCATCTCCTGG + Intergenic
1086537457 11:87865301-87865323 GTGGTCTCCAGGTAATCACAAGG + Intergenic
1090717326 11:129441928-129441950 CTGAGCACCACGGCATCCCAGGG - Intronic
1092050111 12:5463072-5463094 GTGGTCTGCAGGGCATCCCAGGG + Intronic
1100327289 12:93551458-93551480 AGGATCACCAGGTCAGCACAGGG + Intergenic
1103965774 12:124638469-124638491 GTGATCTCCAGGACGTCCCTAGG + Intergenic
1104266866 12:127241824-127241846 GTGGCCACAAGGTCATGCCAAGG - Intergenic
1104751795 12:131244795-131244817 AGAATCACCAGGTCACCCCAGGG - Intergenic
1104780098 12:131414280-131414302 AGAATCACCAGGTCACCCCAGGG + Intergenic
1105996387 13:25676419-25676441 GAAATAACCAGGTCATCTCAGGG + Intronic
1108533289 13:51347099-51347121 GTGAGCACCATGTCCTTCCAAGG + Exonic
1111681548 13:91447875-91447897 GTGAGCCCCAGGGCATTCCAAGG - Intronic
1113420875 13:110170595-110170617 GGGATCCCCAGGCCATGCCACGG - Exonic
1119738001 14:76996157-76996179 GTGATCAGCAGGTGGTCCCTGGG - Intergenic
1121991409 14:98561380-98561402 GTGCTGAGCAGCTCATCCCATGG - Intergenic
1122079680 14:99257965-99257987 GAGCTCACCAGGTCCTCCCCGGG + Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122457253 14:101863984-101864006 GTGCTCTCCAGGTCATCCTCAGG + Intronic
1124429972 15:29598492-29598514 GTGTTCATCAGGTCATGACATGG + Intergenic
1124694696 15:31854275-31854297 GTGGGCCCCAGGTCATCACAAGG - Intronic
1126310051 15:47305314-47305336 GTGATCACCAGGTCATCCCATGG - Intronic
1130703848 15:86213054-86213076 GTGATCACCAAATCATTGCAAGG + Intronic
1132858578 16:2058506-2058528 GTGAGCTACAGGTCATGCCAGGG - Intronic
1132867670 16:2101900-2101922 GTGCTCACGAGGTCATTCCCAGG + Intronic
1134524108 16:14931214-14931236 GTGCTCACGAGGTCATTCCCAGG - Intronic
1134548795 16:15129721-15129743 GTGCTCACGAGGTCATTCCCAGG + Intronic
1134711699 16:16329699-16329721 GTGCTCACGAGGTCATTCCCAGG - Intergenic
1134719551 16:16372998-16373020 GTGCTCACGAGGTCATTCCCAGG - Intergenic
1134947875 16:18338887-18338909 GTGCTCACGAGGTCATTCCCAGG + Intergenic
1134955129 16:18378994-18379016 GTGCTCACGAGGTCATTCCCAGG + Intergenic
1135068947 16:19335550-19335572 GTGATGTCAAGGTCATCCCTGGG - Intergenic
1137520937 16:49195059-49195081 GTGAGCAGGAGGTCAGCCCATGG + Intergenic
1137585918 16:49664099-49664121 CTGCTCACCAGGGCGTCCCAGGG + Intronic
1141515723 16:84543709-84543731 GGGGCCACTAGGTCATCCCAGGG + Intronic
1152112491 17:78365057-78365079 GTGTTCACCAAGCCATGCCACGG - Intergenic
1152598834 17:81251401-81251423 GTGATGCCCAGGTCATCCTCGGG - Intronic
1158909264 18:62043229-62043251 GAGCTCACCAGGTTCTCCCAAGG + Intergenic
1160436543 18:78856520-78856542 AGGATCACCAGGTCAGCCCATGG - Intergenic
1161729344 19:5949622-5949644 GTGCCCACAAGCTCATCCCAAGG + Intronic
1163668652 19:18614660-18614682 GTGACCACCAGCTCATCACAGGG - Intronic
1167552965 19:50173716-50173738 CAAATCACAAGGTCATCCCAGGG + Intergenic
929798110 2:45075700-45075722 GTGTTCACCAAGTCAGCACATGG - Intergenic
939647005 2:144712474-144712496 GTGATTACCAGGTCAAGCCAGGG - Intergenic
942660277 2:178256590-178256612 GAGTTCACCAGGTCATTTCATGG + Intronic
1172512055 20:35507732-35507754 GTGAGCTCCAGTTCATCCTAGGG - Exonic
1172693429 20:36805719-36805741 GTTATTGCCTGGTCATCCCAGGG - Intronic
1174663218 20:52233808-52233830 GTGCTCACCAGGGCATCTCTGGG + Intergenic
1174980857 20:55392969-55392991 GTGATCACAAGGTCTTCCCATGG + Intergenic
1175182657 20:57159583-57159605 GTGAGCCCCATGTCATCACAGGG + Intergenic
1175789992 20:61735101-61735123 GAGATCTCCAGATCAGCCCAGGG - Intronic
1176295172 21:5068091-5068113 GTGGGCGCCAGGTCATCACAGGG - Intergenic
1178628159 21:34235872-34235894 GTGTTCAACAGAACATCCCAGGG - Intergenic
1179861877 21:44194037-44194059 GTGGGCGCCAGGTCATCACAGGG + Intergenic
1181558812 22:23687884-23687906 GTTATATCCAGGTCTTCCCAAGG + Intergenic
957825917 3:85443783-85443805 GAGATCACCAAGTGATCACAAGG - Intronic
960427728 3:117529681-117529703 ATGGTCCCCAGGCCATCCCATGG + Intergenic
960950436 3:122995411-122995433 GTGGCCACCCTGTCATCCCAGGG - Intronic
961173047 3:124812671-124812693 GAAATCACCAAGTCTTCCCAAGG - Intronic
962579359 3:136783889-136783911 GTGATCACTCTGGCATCCCAAGG + Intergenic
963785509 3:149530804-149530826 TTAATCACCAAGTCATCCTAAGG + Intronic
967769286 3:193316344-193316366 TGGATCACCAGGTGATCCAATGG - Intronic
968631960 4:1656464-1656486 GTCACCCCAAGGTCATCCCAGGG - Intronic
968805027 4:2766738-2766760 GTGATCCCAATGTCATCACAGGG + Intergenic
969614999 4:8247157-8247179 GTGCTCACCAGGCCAGCCCTCGG + Intergenic
971081450 4:23216967-23216989 TTGATCACATGGTCAGCCCAGGG + Intergenic
972997009 4:44892975-44892997 CTTCTCACCAGGTCATCACATGG - Intergenic
973640092 4:52893908-52893930 GGGCTCCCCAGGACATCCCATGG + Intronic
980136127 4:128860553-128860575 GTGATCACCGGGGCATGCCAGGG - Intronic
980788211 4:137581975-137581997 GTGTTCACCAGGCCATACCAAGG + Intergenic
983028746 4:162771693-162771715 GTCATAACTAGGTTATCCCATGG - Intergenic
991404088 5:66284805-66284827 CAGATCACCTTGTCATCCCAGGG - Intergenic
997480558 5:134181137-134181159 ATGATCACCCAGTCATTCCAGGG - Intronic
998593966 5:143508146-143508168 CAGATCACAAGGTCATCACAAGG + Intergenic
1001425569 5:171619874-171619896 CTGATGCCCAGGCCATCCCAGGG + Intergenic
1002334936 5:178471051-178471073 GGAATCCCCAGGTGATCCCAAGG - Intronic
1014001931 6:116373664-116373686 ATGACCACCAGGTCCTCTCAGGG - Intronic
1015123909 6:129731073-129731095 GAGATTACTAGGGCATCCCATGG - Intergenic
1016464937 6:144315827-144315849 ATCATCACCAGATCATGCCAAGG - Intronic
1019374738 7:683420-683442 GTGATCACCAGATCACACCAAGG + Intronic
1022108171 7:27211527-27211549 CTGAACACCAGTTCTTCCCAGGG - Intergenic
1026586608 7:71660860-71660882 GTGATCACCAGCACAGCTCATGG - Intronic
1028220769 7:88194337-88194359 GTGGTCACCTGCTCAGCCCAGGG - Intronic
1034140187 7:148808202-148808224 GAGGCCACCGGGTCATCCCAAGG + Intronic
1034719370 7:153275110-153275132 GTTAGTAGCAGGTCATCCCATGG - Intergenic
1035186506 7:157130206-157130228 GTGGACCCCATGTCATCCCAGGG + Intergenic
1043281873 8:78478410-78478432 ATAATCACCAGGGCATCCCCAGG + Intergenic
1047544416 8:125802105-125802127 GTGATCACTAGGAAGTCCCAAGG - Intergenic
1048456209 8:134580478-134580500 GAGCTCACAAGGTCATCCCCAGG + Intronic
1048642099 8:136375146-136375168 GTGAGCAACAGGTCAACCCAAGG - Intergenic
1053572198 9:39320791-39320813 GTGGTCACCACGGCACCCCAAGG - Intergenic
1053623593 9:39845327-39845349 GTGGTCACCACGGCACCCCAAGG - Intergenic
1053881276 9:42597901-42597923 GTGGTCACCACGGCACCCCAAGG + Intergenic
1053891390 9:42696412-42696434 GTGGTCACCACGGCACCCCAAGG - Intergenic
1054093757 9:60879502-60879524 GTGGTCACCACGGCACCCCAAGG - Intergenic
1054115235 9:61155426-61155448 GTGGTCACCACGGCACCCCAAGG - Intergenic
1054124947 9:61298220-61298242 GTGGTCACCACGGCACCCCAAGG + Intergenic
1054220307 9:62405372-62405394 GTGGTCACCACGGCACCCCAAGG + Intergenic
1054230408 9:62503800-62503822 GTGGTCACCACGGCACCCCAAGG - Intergenic
1054592521 9:67027116-67027138 GTGGTCACCACGGCACCCCAAGG + Intergenic
1055775108 9:79759541-79759563 GTTATCACCAGATCATGACAGGG + Intergenic
1057752805 9:97805577-97805599 GTAATCACTAAGTCATCCCAAGG - Intergenic
1058867162 9:109171304-109171326 GTGGTCGCCAGGTGATGCCAGGG + Intergenic
1059756188 9:117295914-117295936 GAGATCAGCTGGTCATCGCAGGG + Intronic
1060156153 9:121321150-121321172 GTGATTAAAAGTTCATCCCATGG + Intronic
1062342951 9:136101900-136101922 GTGAGCTCCAGCTCATCCCCAGG + Intergenic
1185720594 X:2378199-2378221 CTGACCACCTGGTCATCCAAGGG - Intronic
1186220693 X:7346029-7346051 GTGGTCCCCAGGCAATCCCAGGG + Intronic
1188678911 X:32977447-32977469 TGGATCACCAGGTCATTACAGGG + Intronic
1192682325 X:73264505-73264527 GTGATCAGCACATCCTCCCATGG + Intergenic
1192808177 X:74528209-74528231 GTCAGAGCCAGGTCATCCCAGGG - Intronic
1198546060 X:137693995-137694017 GGGAAAACCAGGTAATCCCAGGG + Intergenic
1200124947 X:153808811-153808833 GGGATCACCAAGTCACACCAAGG + Intronic