ID: 1126310364

View in Genome Browser
Species Human (GRCh38)
Location 15:47309157-47309179
Sequence GTGAAAAGCAAAACCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126310364_1126310369 23 Left 1126310364 15:47309157-47309179 CCATCAGTGGTTTTGCTTTTCAC 0: 1
1: 0
2: 2
3: 38
4: 338
Right 1126310369 15:47309203-47309225 CACCATTTGGAAATATTAAATGG 0: 1
1: 0
2: 6
3: 42
4: 381
1126310364_1126310365 10 Left 1126310364 15:47309157-47309179 CCATCAGTGGTTTTGCTTTTCAC 0: 1
1: 0
2: 2
3: 38
4: 338
Right 1126310365 15:47309190-47309212 TCCCCATGTCAATCACCATTTGG 0: 1
1: 0
2: 0
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126310364 Original CRISPR GTGAAAAGCAAAACCACTGA TGG (reversed) Intronic
901381163 1:8875494-8875516 GTCACAAGCAAAACCACCTAGGG + Intronic
903247626 1:22027644-22027666 GGGAAAAGCAGAATCACTTAGGG - Intergenic
903306687 1:22417876-22417898 GTGAAAAGGAAAATCACAGAGGG - Intergenic
903916573 1:26769076-26769098 ATGAGAAGCAAAGCCACGGAAGG + Intronic
903949924 1:26990659-26990681 GTGATAAGCAAAACCAGTCAAGG + Intergenic
904104434 1:28066297-28066319 GCCAAAAGCAAAACTACAGATGG + Intronic
904819282 1:33230437-33230459 AGGAAAAGCAAAACCAGTCATGG + Intergenic
905234634 1:36537662-36537684 GTGAAAAGTGAAACCTCTGAAGG - Intergenic
905766063 1:40602153-40602175 GGGAAAAGAAATAACACTGAAGG - Intergenic
905845420 1:41227081-41227103 GTGCAATGGAAAGCCACTGAAGG - Intronic
906339436 1:44965987-44966009 GTTAAAAGCATAGCCTCTGAAGG + Intronic
906902164 1:49846531-49846553 GTGAAGAGACAATCCACTGAAGG + Intronic
907301738 1:53491049-53491071 CTGCAGATCAAAACCACTGAAGG - Intergenic
907819978 1:57957719-57957741 GTAGAAAGAAAAACCTCTGATGG + Intronic
908623584 1:66014229-66014251 GTGAAAAGCCAGTCCACAGAAGG - Intronic
908775452 1:67635024-67635046 GGGCAAATCAAAGCCACTGAGGG + Intergenic
909791621 1:79686616-79686638 GTGAAAAGGAAAATCAGAGAAGG + Intergenic
910487711 1:87733701-87733723 AAGAAAAGCAAAACTACTGTAGG + Intergenic
911393540 1:97276585-97276607 ATGAAAATCAAAACCACAAAGGG + Intronic
911693910 1:100865927-100865949 GTGAAAAGTAAAAGGACTAAGGG - Intergenic
911717874 1:101155545-101155567 GTGAAAATAAAAAACACTGAAGG + Intergenic
912310811 1:108619322-108619344 GAGAAAAGAAAAACTACTGAGGG - Intronic
914237835 1:145828303-145828325 GAGCAAAGGAAGACCACTGAAGG + Intronic
914435880 1:147658906-147658928 GTGAGAAGCAAGACCCCTCAGGG + Intronic
915412140 1:155709730-155709752 GTGAAAAGGTAAACCACAAATGG - Intronic
916257537 1:162805018-162805040 GTGAATAGCAAAAATCCTGAAGG - Intronic
918253600 1:182726800-182726822 GTGAGAAGGAAAACCCATGATGG + Intergenic
918311607 1:183289299-183289321 ATGAAAAGCAATGCCACCGATGG - Intronic
919794648 1:201313974-201313996 GTGTAAATCAGAATCACTGAAGG - Intronic
920365641 1:205446952-205446974 GGGAAAAGGAAAACCAGTGATGG + Intronic
920969476 1:210730767-210730789 GAACAAAGCAAAAACACTGAGGG - Intronic
921535063 1:216338610-216338632 TTTAAAAGTCAAACCACTGAAGG + Intronic
922147743 1:222964999-222965021 TTGAAAAAAAAAACTACTGAAGG - Intronic
922392973 1:225166206-225166228 CTCAAAAGTAAAACCATTGATGG - Intronic
924053332 1:240099507-240099529 GTGCAGAGCAGAAACACTGAGGG - Intronic
924865995 1:247981107-247981129 GTTAGCAGCAAAACCACTGTTGG - Intronic
1063282650 10:4647604-4647626 GTGAGAAGCAAAACCACAGCAGG - Intergenic
1064778977 10:18812323-18812345 GTGAAAAGATAAACCACAGAGGG - Intergenic
1065402403 10:25320413-25320435 GTGAAGAGCAGACCCACAGATGG - Intronic
1065730379 10:28704810-28704832 GGGATAAGAAAAACCCCTGAAGG + Intergenic
1066723983 10:38370704-38370726 GTGAATAGCAAAAATCCTGAAGG - Intergenic
1068572688 10:58648352-58648374 GTGAACACAAAAAACACTGAAGG - Intronic
1068916196 10:62434319-62434341 ATGAAAAACAAATCAACTGATGG + Intronic
1069027588 10:63560495-63560517 ATGAAAAATAAAACCACTTATGG - Intronic
1069975704 10:72211101-72211123 TTGGAAAGCGAAACCACAGATGG - Intronic
1070061097 10:72983801-72983823 GAGAAAAAAAAAACAACTGATGG - Intergenic
1070175828 10:73968430-73968452 CTGCACAGCCAAACCACTGAGGG + Intergenic
1073229567 10:101957315-101957337 GTAAATAGCAAACCCTCTGAAGG - Intronic
1074069660 10:110053641-110053663 GTGAAAATTAAGACTACTGATGG - Intronic
1074332852 10:112536521-112536543 TTAAAAAGCAAAATCACTGAAGG - Intronic
1074685513 10:115959232-115959254 GATAAAAGCCAATCCACTGAGGG - Intergenic
1074913764 10:117936510-117936532 GTGAAAGGAAACAGCACTGAAGG + Intergenic
1075207903 10:120462639-120462661 GTCCAAAGCAAAGCTACTGAAGG + Intronic
1076040906 10:127247749-127247771 AAGAAAAGCAAAACCCTTGAGGG - Intronic
1076100341 10:127772610-127772632 GTGAAAAGCATAATCAAGGAAGG + Intergenic
1076562493 10:131376326-131376348 GAGACAAGCAGAACCACAGATGG - Intergenic
1076572943 10:131444396-131444418 GGCAACAGCAAAACCACAGAAGG + Intergenic
1077353590 11:2104394-2104416 ATGAAAAGCAAGAACACAGATGG + Intergenic
1077518447 11:3016516-3016538 TTGAAAAGCAAAACCACGCCAGG - Intronic
1077761815 11:5109046-5109068 CTGTAAAACAAAAACACTGAGGG + Intergenic
1078075532 11:8156672-8156694 GAGGAAAGCAAAGCCACTGGAGG - Intronic
1078325835 11:10380174-10380196 ATGAGAAGCAAAACCACTTGGGG + Intronic
1078680292 11:13469446-13469468 GTGAAGAACCAGACCACTGAGGG - Intergenic
1078758918 11:14236074-14236096 GTGAGATGCAAAGCCACTGGAGG + Intronic
1079891860 11:26065891-26065913 TTGAGAAGGAAAACCTCTGAGGG - Intergenic
1079948271 11:26769977-26769999 GTGAAATGCAAGACACCTGAGGG - Intergenic
1080734179 11:34994886-34994908 GGGAAAAGAAAAAGCTCTGAAGG - Intronic
1081396454 11:42591775-42591797 GTGCACAGCAAAAGCTCTGAGGG - Intergenic
1082761306 11:57129745-57129767 GTGAAAATCATATCCAATGATGG - Intergenic
1085453547 11:76653401-76653423 GTGAAGGGCAAGATCACTGAGGG - Intergenic
1086231081 11:84570600-84570622 GTGGAAGGCAAAATCAGTGATGG - Intronic
1086274115 11:85104745-85104767 TTGAAAAACAAAAAAACTGATGG + Intronic
1086502410 11:87466932-87466954 AGGAAAAGCAAAACCCCAGAAGG - Intergenic
1087906623 11:103704834-103704856 TGGAAAATGAAAACCACTGAAGG - Intergenic
1087919289 11:103847917-103847939 GTGAGAAGGAAAACCATTGGGGG - Intergenic
1087974365 11:104526125-104526147 TGGAAAAACAAAACCACAGAAGG - Intergenic
1094172341 12:27506677-27506699 AAGAAATGGAAAACCACTGAAGG - Intergenic
1095169300 12:39014988-39015010 GTGAAATAGAAAACCACTGGTGG - Intergenic
1095675596 12:44914187-44914209 GTGAGATGGAAAACCACTGAGGG - Intronic
1095741948 12:45617104-45617126 GTGAAAAGCACAAACACGAAGGG - Intergenic
1096452905 12:51759586-51759608 GCAGAAAGCAAAACCACAGATGG + Intronic
1096882866 12:54686714-54686736 GTGAGAAGCAAAACCACTGGAGG + Intergenic
1097928185 12:65154950-65154972 ATGAAAAGGCAAACCACAGATGG - Intergenic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1098846893 12:75548308-75548330 GTGAAAAGCAGAAAGAATGAAGG - Intergenic
1100018493 12:90041390-90041412 TAGAAAAGCCAAACCACAGAAGG - Intergenic
1100833834 12:98546052-98546074 GTAAAAAACAAAATCAATGAGGG + Intronic
1102775145 12:115512143-115512165 ATGAAAAACAAAATCACTGAAGG - Intergenic
1103079705 12:118013960-118013982 GCAAGGAGCAAAACCACTGAAGG + Intronic
1104309405 12:127640849-127640871 ATTAAAAGGAAAACCAGTGAGGG + Intergenic
1104654502 12:130563861-130563883 TTGAAACGGAAAACCACTGCAGG - Intronic
1106105609 13:26730328-26730350 GCGAAAACCAAAACCCCTAATGG - Intergenic
1106970584 13:35136842-35136864 GTCAAAAGAAAAACCACAAATGG + Intronic
1107059093 13:36136190-36136212 AAGAAAAGGAAAATCACTGAAGG + Intergenic
1107197727 13:37673538-37673560 GGGAAAAGGAAAATCAGTGAAGG + Intronic
1107421394 13:40250412-40250434 GTCAGAAGCACAACCACTGTGGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109947328 13:69453877-69453899 GTGAAAAGCAAGACTAGGGAGGG - Intergenic
1110201470 13:72854934-72854956 GTTAAAAGGAAAATAACTGATGG + Intronic
1110506470 13:76293510-76293532 GTGAAAAGCAAAACGAGACAAGG + Intergenic
1110514870 13:76398331-76398353 GTAAAAAGCAAAATCTATGAAGG + Intergenic
1111198910 13:84908012-84908034 ATAAATAGCAAAACCACTAATGG + Intergenic
1111647993 13:91056387-91056409 ATGAAATGCAAAACAACTCAGGG + Intergenic
1111961700 13:94818061-94818083 GTGAAAAGACAAGCCACTGAGGG - Intergenic
1112164921 13:96907914-96907936 GTAAGGAGAAAAACCACTGAGGG - Intergenic
1112711386 13:102132820-102132842 GTCAAAAGTAAACCCACTTAAGG - Intronic
1113909081 13:113833441-113833463 TTAAAAAGCAAAACCACAGGTGG - Intronic
1114707970 14:24746720-24746742 TTAAAAAGCACAACCCCTGATGG - Intergenic
1115691698 14:35850494-35850516 GTGAAAAGGCAACCTACTGAAGG - Intronic
1116245583 14:42407342-42407364 GCCGAAAGCAAAACCACTGGTGG - Intergenic
1116836578 14:49774218-49774240 CTCAAAAGCAAAACAACTTATGG + Intronic
1117108938 14:52428489-52428511 GTACAAAGCAAAGCCACTGGGGG - Intergenic
1117200115 14:53381567-53381589 GTGAAATGCAAAATCACGCAGGG + Intergenic
1117487395 14:56212270-56212292 GTGAAAAGCAAAGCAACGTAGGG - Intronic
1117787115 14:59297604-59297626 ACGGAAAGCAAAACCACGGAGGG - Intronic
1118320736 14:64751660-64751682 GTGAGAATCAAATACACTGATGG - Intronic
1118788038 14:69063014-69063036 ATAAAAACCAAAACCACTGGGGG + Intronic
1119221689 14:72913590-72913612 GTTACCAGCAAACCCACTGAAGG - Intergenic
1120244555 14:81991703-81991725 ATGAAAAACAAAGCCTCTGAAGG + Intergenic
1121614364 14:95303270-95303292 GAGAAAAGCCACACCGCTGAGGG - Intronic
1121952087 14:98180024-98180046 GTGAAACTCAGAACCAATGATGG + Intergenic
1123215189 14:106802889-106802911 GTGCATAGCAGAGCCACTGAAGG + Intergenic
1123398537 15:19961314-19961336 GTGAAAAGACAAAGCACTGCTGG + Intergenic
1123812263 15:23939577-23939599 GTAAAAAGAAAAACCAAAGAAGG - Intergenic
1124218326 15:27827846-27827868 GTAAAAAGCAAAAACATGGATGG - Intronic
1125383052 15:39107910-39107932 GTGAGAAGCAAAATCACAGCAGG + Intergenic
1126109926 15:45169133-45169155 GTGGAAAGCAGAACCAGTGAGGG + Intronic
1126310364 15:47309157-47309179 GTGAAAAGCAAAACCACTGATGG - Intronic
1126927612 15:53608028-53608050 GAGAAAAGAAAATCCACTGTTGG + Intronic
1126938381 15:53737534-53737556 CTTTAAAGCAAAACCACTGTTGG + Intronic
1127340826 15:58041990-58042012 GTGGAAAGCAAAACCATGAATGG + Intronic
1129550443 15:76443031-76443053 GTAAAAAACACCACCACTGAGGG + Intronic
1129712598 15:77828155-77828177 GTGCAAAGTCAAACTACTGAGGG - Intergenic
1130065422 15:80599335-80599357 ATGAAAAGATAAGCCACTGATGG + Intergenic
1130763197 15:86842248-86842270 CTTAAAAGCAAAAACACTCAAGG - Intronic
1130809250 15:87359238-87359260 GTGAAGAACAAAACCAGTGAGGG - Intergenic
1132067051 15:98740198-98740220 GTGGCAAGCAAAACAAATGAAGG - Intronic
1133507565 16:6426941-6426963 CTGAAAAGGCAAAACACTGATGG - Intronic
1134094152 16:11407867-11407889 CTGAAAAGCAGAATCACTGCGGG + Intronic
1134210651 16:12273656-12273678 GTGAATATAAAAACCACTGAGGG - Intronic
1134606033 16:15571868-15571890 GTAAAATGCAAATTCACTGAGGG + Intronic
1135534609 16:23283658-23283680 CTGAAAAACAAAACCATTGTAGG + Intronic
1140047294 16:71449702-71449724 GAGAAGAGCAACACCATTGATGG - Exonic
1141870332 16:86781014-86781036 GTGTATAACAAAACCACTTAAGG + Intergenic
1143385673 17:6528984-6529006 GTGAAAAGCAAAATCAACCAGGG - Intronic
1143429275 17:6867867-6867889 ATGAGAAACAAAACCACTAAGGG - Intergenic
1143454542 17:7057873-7057895 GGAAAAAGCTAAAACACTGAGGG - Intergenic
1148685754 17:49500236-49500258 GTGAAAAGCAAAAATGATGAGGG + Intronic
1154149765 18:11897083-11897105 GTGAAAACCACAGCCTCTGATGG - Exonic
1155202344 18:23528121-23528143 GGGAAAAACAAAAACAGTGAAGG - Intronic
1156071908 18:33221703-33221725 ATCAAAAGCAAAGCCAGTGAAGG + Intronic
1156215388 18:34992976-34992998 GGAAAAAGCAGAACCACTGATGG + Intronic
1156372151 18:36481147-36481169 GAGAAAAGCAACAGGACTGAAGG + Intronic
1157401069 18:47388502-47388524 GTGAAAAGCAAAAACCATAAAGG - Intergenic
1157999432 18:52599080-52599102 GTGAACAGTCAAACCACAGATGG + Intronic
1159201811 18:65196036-65196058 GTGAAAAGGGAAGCCATTGATGG - Intergenic
1159610883 18:70524461-70524483 ATGGAAAGCAAAACAAATGAGGG + Intergenic
1159793999 18:72820366-72820388 CTGGAAAGCAAAATCAATGATGG + Intronic
1160302508 18:77696872-77696894 GTGCTAATCAAAACCACAGAAGG - Intergenic
1164059587 19:21659179-21659201 GTGAAAAGAAAAATAACTAAAGG - Intergenic
1164067037 19:21723864-21723886 GTGAAAAGAAAAATAACTAAAGG + Exonic
1168651247 19:58093689-58093711 GTGAAAAGACAAGCCACAGATGG - Intronic
926887960 2:17614769-17614791 GAAAAATGCAAAACCACTCATGG + Intronic
927097710 2:19760174-19760196 GGGTAAGGCAAAACCACAGACGG + Intergenic
927123983 2:19996521-19996543 CTGACAAGCAAAAGCATTGAGGG + Intronic
927425901 2:22980708-22980730 ATGAGAAGAAAAATCACTGAAGG - Intergenic
928724734 2:34159197-34159219 GTAAAAAGAAAAATCACTGCTGG - Intergenic
929008933 2:37422217-37422239 GTGGAAGACAAAACCACGGATGG - Intergenic
929974697 2:46621172-46621194 GTGAAAAAGAAAACCAGTGGCGG - Intronic
931017817 2:58006073-58006095 GTAAAAAGTATAACCCCTGAGGG + Intronic
931797829 2:65728716-65728738 AGTAAAAGCAAAACCAGTGATGG + Intergenic
932424276 2:71619391-71619413 GTGAAAAGACACATCACTGAGGG - Intronic
933177198 2:79188607-79188629 GAGAGAAGAAAAATCACTGAAGG + Intronic
933411588 2:81932109-81932131 GTAAAAAGCAAAAGAAGTGAAGG - Intergenic
933888153 2:86739619-86739641 GTGTAAAGCAAAATCACCAAAGG + Intronic
933922025 2:87057087-87057109 GTGTAAAGCAAAATCACCAAAGG - Intergenic
936607862 2:113975901-113975923 GGGAAAAGAAAAACAACTGAAGG + Intergenic
936952149 2:117988597-117988619 GTGAAAGGCAGAATTACTGACGG - Intronic
937779070 2:125816439-125816461 GGGAAATGGAAAACCGCTGAAGG + Intergenic
939631743 2:144533963-144533985 ATGAAATGGAGAACCACTGATGG - Intergenic
940384185 2:153050961-153050983 GAGAGAAGAAAAGCCACTGAGGG + Intergenic
940432102 2:153604469-153604491 GTCAAAAGCCAAATAACTGAGGG - Intergenic
940442466 2:153734219-153734241 CTGAAAAGCAAAACCTCTTCTGG - Intergenic
940565291 2:155352469-155352491 ATGGAAAGTAAAACCACAGATGG - Intergenic
940807541 2:158205050-158205072 GTGTGAAGAAAAACCACAGAAGG + Intronic
941097371 2:161254104-161254126 TTGGAAAGGAAAACTACTGAAGG - Intergenic
941483903 2:166054569-166054591 CTTAAAAGCATAAGCACTGATGG + Intronic
942068579 2:172294876-172294898 GTGAAAAACAAAACGTCTGGAGG + Intergenic
943006819 2:182395288-182395310 GTGAAAAGGAAAAGCAATCAAGG - Intronic
943981138 2:194552349-194552371 AAGAAAAGAGAAACCACTGATGG + Intergenic
944285255 2:197942252-197942274 GTGAAAAGGAAAACTAAAGATGG - Intronic
944754148 2:202742248-202742270 GTGAAAAGGAAAAACTATGAGGG + Intronic
945508000 2:210665296-210665318 AAGAAAAAAAAAACCACTGATGG - Intronic
946766732 2:223047442-223047464 GGGAAAAGCAAAACCAGTGGTGG + Intergenic
947790652 2:232866243-232866265 AGCAAAAGCAAAAACACTGAAGG - Intronic
947846446 2:233247934-233247956 GTGAAGAGCAAAGTCAGTGATGG - Intronic
947960030 2:234228782-234228804 GGAAAAAGAAAAACCACTGCTGG + Intergenic
1169650649 20:7863495-7863517 ATGAAAATCAAAACCACTATGGG + Intergenic
1169974512 20:11309022-11309044 ATGCAAAACAAAACCACAGAAGG + Intergenic
1170135803 20:13072437-13072459 GTGAAAAGAAAAACCTTTCAAGG + Intronic
1170388211 20:15843438-15843460 TTCAAAAGCAAAAGCACTGGAGG - Intronic
1170952396 20:20948895-20948917 GTGCAAAGCAAAGCCCCTCATGG - Intergenic
1171131939 20:22661998-22662020 GTGGAAAGCAAAATCAATGCTGG + Intergenic
1172460026 20:35110573-35110595 GTGAAAAGCACATCCACAGGGGG + Intergenic
1172757907 20:37300141-37300163 GTAAAATGTAAAGCCACTGAAGG - Intronic
1172793777 20:37523471-37523493 GGGAAAAGCAAGATCAGTGAGGG - Exonic
1175058277 20:56218105-56218127 GCGAAAAGGAAAACCACAGGGGG + Intergenic
1175471799 20:59235319-59235341 GAGAAAAGCAGAACCCCTGTGGG - Intronic
1176273739 20:64251280-64251302 ATGGAAAGCAAAACCACAGATGG - Intergenic
1176521629 21:7829168-7829190 AAGAAAATCAAAACCACTCACGG - Intronic
1176662332 21:9649229-9649251 TTCCAAAGCACAACCACTGATGG - Intergenic
1176745229 21:10646056-10646078 GTGAAAAGACAAAGCACTGCTGG + Intergenic
1177094473 21:16815483-16815505 GTGTAAAATGAAACCACTGAAGG - Intergenic
1177566022 21:22821232-22821254 GTGGAAAGTAAAATAACTGAAGG + Intergenic
1177764832 21:25445637-25445659 GCTAAAAGCAGAACCACTGTTGG + Intergenic
1177820950 21:26030291-26030313 GTGAAATGCATAACCTGTGAAGG + Intronic
1178613859 21:34112851-34112873 GAGAAACACAAAACCACTGAGGG + Intronic
1178655649 21:34459180-34459202 AAGAAAATCAAAACCACTCACGG - Intergenic
1181301796 22:21885492-21885514 GTGAAAACCACAGCCTCTGATGG - Intergenic
1184546627 22:45174101-45174123 GGGAACAGTAAAACCAATGAGGG + Intronic
1184958323 22:47908528-47908550 GTAAAAAGAAAACCCTCTGAAGG - Intergenic
949224575 3:1678800-1678822 GTGACAAGCAAAATGACTGGGGG - Intergenic
950008221 3:9704742-9704764 GTGTAAAGCACCACCACTGCAGG - Exonic
950337590 3:12209991-12210013 GTAAAAAGCAAAACCCCAAAAGG - Intergenic
950663021 3:14478441-14478463 GTGAAGAAAAAAACCACAGAAGG - Intronic
951020381 3:17776168-17776190 CTGAAAGACAAAACCACTCATGG - Intronic
951099281 3:18668039-18668061 TTGAAAAGCAGAACCACACATGG - Intergenic
951940132 3:28068887-28068909 ATGAAGAGAAAAACCAGTGAAGG + Intergenic
953021798 3:39119227-39119249 GCCAAAAGCAAAACCAAGGATGG - Intronic
955107532 3:55912919-55912941 GTTAAAAGAAGAAGCACTGATGG - Intronic
956078525 3:65532677-65532699 GGGAAAGGCAAAACTACAGAAGG + Intronic
957035765 3:75291125-75291147 GAGAAAAGGCAAACCACTGAGGG + Intergenic
957555258 3:81758819-81758841 GTGAAAAGAACAACTAATGAAGG + Intronic
958842638 3:99226411-99226433 GTGAAAAGACAACCCACAGAAGG - Intergenic
958940170 3:100303324-100303346 TTGAAAAGCAAAATCAGAGAAGG + Intronic
959968803 3:112385203-112385225 AAGAAAGGCAAAACCACTGCAGG - Intergenic
960799200 3:121521097-121521119 ATAGAAAGCAAAACCACAGATGG - Intronic
961037242 3:123651060-123651082 GTGGCAAGCAAGACCACTGAAGG + Intronic
961304269 3:125945587-125945609 GAGAAAAGGCAAACCACTGAAGG - Intergenic
961386811 3:126527397-126527419 GAGAAAAGCTAAACCACAGCTGG - Intronic
963452215 3:145496515-145496537 GCCAAAAGTAAAACCAATGATGG - Intergenic
963759187 3:149269219-149269241 GAGAAAAAGAAAACCACTCACGG - Intergenic
964253269 3:154745245-154745267 ATGAAAATCAAAACCACAGTGGG + Intergenic
964652932 3:159032135-159032157 GTGAAAAGATAAGCCACTAATGG - Intronic
964700611 3:159561894-159561916 GGGAAAGGTAAAACCACTGCAGG - Intronic
965422070 3:168473095-168473117 GAGAAATGCAAAAGCACTGCTGG - Intergenic
965546561 3:169922352-169922374 GGGAGAAGCAAAACAAGTGAGGG + Intronic
965723824 3:171692055-171692077 GTGAATATCAAAACAACTGCAGG + Intronic
966436801 3:179894883-179894905 GTCAAAAACAAAACTTCTGAAGG + Intronic
968095327 3:195926140-195926162 ATGAAAAGGCAAACCACAGATGG - Intergenic
968990125 4:3905116-3905138 ATGAAAAGCACAACCAGTGGGGG + Intergenic
969509770 4:7611129-7611151 GTGAAAAGCAAAAGCCCACATGG + Intronic
969660478 4:8524708-8524730 GTGCAAAGACAAACCACAGATGG + Intergenic
969787021 4:9466403-9466425 ATGAAAAGCACAACCAGTGGGGG - Intergenic
970233470 4:13934290-13934312 AGGAAGAGCAAAACCAATGAGGG - Intergenic
970233636 4:13936315-13936337 AGGAAGAGCAAAACCAATGAGGG - Intergenic
973216655 4:47676580-47676602 GTGGTAAGCAAAACCGCTGATGG - Intronic
974476314 4:62386796-62386818 GTGTCAAGCATAACCTCTGAAGG - Intergenic
974550541 4:63367201-63367223 GTGAAAGGCGAAACCAGTGTTGG + Intergenic
974875380 4:67697899-67697921 GAGTAAAGGAAATCCACTGAAGG - Intronic
975792950 4:77974486-77974508 GTGAAAAGTAAATCCACAAATGG - Intergenic
975825779 4:78318254-78318276 GTGAAAAGCAAAGCCAAATAAGG - Intronic
976027532 4:80708158-80708180 ATGAAAATCAAAACAAATGAAGG - Intronic
977095346 4:92735493-92735515 GTGAAAAACAAAACTGCAGATGG + Intronic
977605890 4:98984680-98984702 GAGAAGAGCATTACCACTGAGGG - Intergenic
977701013 4:100022862-100022884 GTAAAACGGAAAGCCACTGAAGG - Intergenic
978563812 4:110061148-110061170 GTGCAGAGAAAAACCACTGAAGG - Intronic
978742125 4:112148217-112148239 GTGGAAAGAAAAATCAGTGAAGG - Intronic
980108047 4:128607389-128607411 GTGATGAGCAAAACCATTGTAGG + Intergenic
980120372 4:128721847-128721869 GGAAAAAGGAAAACCAATGAGGG - Intergenic
981657117 4:147124506-147124528 GTGAAATGCAGAGCCACTGGAGG - Intergenic
981802618 4:148676153-148676175 GGTAAATGCAAACCCACTGAAGG - Intergenic
982149837 4:152441305-152441327 GAGAAAATCAAAGCTACTGATGG - Intronic
982532794 4:156568000-156568022 GTGGAAAGCAAGACCCCTGAGGG + Intergenic
983224965 4:165077352-165077374 TTGAAAAGAAAAACAACTGAAGG + Exonic
983387290 4:167081559-167081581 AGGAAAAGCAAAACCAAGGATGG + Intronic
985413060 4:189707297-189707319 TTCCAAAGCACAACCACTGATGG + Intergenic
986174331 5:5339253-5339275 GAGAAATGCAAAACAACGGAGGG + Intergenic
987289006 5:16490190-16490212 GTGCAAAGCAAATCCACCCATGG + Intronic
987289219 5:16492124-16492146 TTGAAAAGCAAAACCAAAAAGGG - Intronic
987575331 5:19720922-19720944 GTGACAAGCAAAATCAATGTAGG + Intronic
988101904 5:26690326-26690348 GTGAAAAGCAGAAGAACAGATGG - Intergenic
988820093 5:34874748-34874770 TTAAAAAGCAAAACCACAAAAGG + Intronic
989398990 5:40989268-40989290 GTGGAATGCAACATCACTGAGGG + Intergenic
989785260 5:45319623-45319645 GTGAAAAGGCAAGCCACAGATGG - Intronic
990189330 5:53241015-53241037 GAGAAAGGCAAAATCACTGGAGG + Intergenic
990203229 5:53400953-53400975 ATGAAAAGGCAAACCACAGAAGG + Intergenic
991240818 5:64458221-64458243 ATGGAAAGCAAAACTACAGATGG + Intergenic
991661048 5:68951046-68951068 TTGAAAAGCAAATACACTGTAGG - Intergenic
992211350 5:74482942-74482964 GCAAAAAGCAAAACCATGGATGG - Intergenic
992888539 5:81182943-81182965 GTGAAAACCAAAAACAATAAGGG - Intronic
993629817 5:90272350-90272372 GTGAAAAGCAAACTAACTGATGG + Intergenic
994976249 5:106811011-106811033 GTGAGAAGACAAACCACAGATGG - Intergenic
995394604 5:111673954-111673976 CTGGAAAGCAAAACTACTGGGGG + Intronic
998482022 5:142470526-142470548 TTGAACAGGAAAGCCACTGATGG + Intergenic
999227940 5:150042702-150042724 GTGAAATGGAGAGCCACTGAAGG + Intronic
1002574826 5:180168563-180168585 GTGCACAGCAAAACCAAGGAAGG - Intronic
1003071952 6:2951846-2951868 CTGAAACGCAGAACCACTAAGGG + Intronic
1003199350 6:3944734-3944756 CTGAAAATCAAAAGTACTGATGG - Intergenic
1003856550 6:10281901-10281923 GCTACATGCAAAACCACTGAAGG + Intergenic
1004936166 6:20510461-20510483 GTGAAAAGTAAAATCAGTCAAGG + Intergenic
1005377892 6:25202775-25202797 GTGAAAAGCCAAACAACTCATGG - Intergenic
1005473082 6:26181410-26181432 ATGAAAAAAAAAACCTCTGATGG - Intergenic
1005829402 6:29658560-29658582 GACAAAAGCAAAACCTCTAAGGG + Intronic
1007938162 6:45752436-45752458 GTGAGAAGCAAATGCATTGACGG + Intergenic
1008117209 6:47565860-47565882 GTGAAATGCAAAGCTACTGGAGG - Intronic
1008122308 6:47632566-47632588 GGGAAAAGCAAAACCTTTCATGG + Intergenic
1009688444 6:66993504-66993526 AACAAAAGCAAAAACACTGAGGG - Intergenic
1012375195 6:98553799-98553821 ATGCAAAGCAAAAGAACTGAAGG + Intergenic
1012718441 6:102707528-102707550 GTGATGTGGAAAACCACTGAAGG - Intergenic
1014222330 6:118810166-118810188 ATGATAAGCAAAACCAATGCTGG - Intergenic
1014695516 6:124616253-124616275 GTGAAATGCAAAAAGCCTGAAGG - Intronic
1015498639 6:133907636-133907658 CTGAAGAGCAAACCCACTGCAGG - Intergenic
1016231102 6:141805111-141805133 GCAGAAAGCAAAACCACAGATGG + Intergenic
1017102374 6:150859974-150859996 GTGATAAGTAAATCCACTGGTGG - Intergenic
1017161574 6:151370555-151370577 ATCAAAAATAAAACCACTGAGGG - Intronic
1017250364 6:152273821-152273843 GGGAAGGGCAAAACCAATGAGGG - Intronic
1017792650 6:157815034-157815056 GAGAAAAGCAAAACAATTTAGGG - Intronic
1017952031 6:159143219-159143241 CAGAGAAGCAGAACCACTGAGGG + Intergenic
1019157549 6:170049434-170049456 AAGAAACACAAAACCACTGAGGG - Intergenic
1019701004 7:2475062-2475084 GTGAGAAGCAAAATCCCTGCTGG + Intronic
1020353661 7:7253075-7253097 CTGAAAAGTAAAACCAATTAGGG - Intergenic
1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG + Intergenic
1022407870 7:30108987-30109009 ATGAAATGCAAACCCACTGAGGG + Intronic
1022751038 7:33226000-33226022 TTGGAAGACAAAACCACTGAAGG - Intronic
1024054304 7:45649826-45649848 GTGAAAACCAAAGTCCCTGATGG + Intronic
1028104694 7:86863179-86863201 GTGAAAAGAAAAAGCATTAAGGG + Intronic
1028273626 7:88823835-88823857 GTAAAAAAGAAAAGCACTGATGG + Intronic
1029076760 7:97940813-97940835 GTGAAAAGGACAACCAGTGGGGG + Intergenic
1030476939 7:110047721-110047743 GAGAAAAGAAAAACCACACATGG - Intergenic
1032209277 7:129897598-129897620 GAAAAAAGCAAAACTACAGATGG + Intronic
1033999727 7:147398335-147398357 GAGAAAAGAAAAGCCACTGTAGG - Intronic
1034130132 7:148708224-148708246 GTCAAATGCAAAAGCCCTGAAGG - Intronic
1034158726 7:148976699-148976721 GTGAAAAACGAAACCCCTGCTGG + Intergenic
1035596649 8:863555-863577 GTGAAGAGAAAACCCACAGATGG - Intergenic
1035832876 8:2716468-2716490 GTGAAGAGCAAAAGTACTCAAGG - Intergenic
1035937451 8:3857405-3857427 GTGAAAAACAAAAACTGTGATGG + Intronic
1037515462 8:19626960-19626982 GTGAAATGTACAACCACTAACGG + Intronic
1039916284 8:41862707-41862729 GAAAAAAGAAAAACCACTGCAGG + Intronic
1040430566 8:47337529-47337551 GTGAAAATAAAACCCAATGATGG - Intronic
1041401164 8:57446833-57446855 GAGAAAAGAAAAGCCACTGATGG + Intergenic
1042893060 8:73634549-73634571 ATGAAATGCAAAACCAATGTAGG - Intronic
1044260675 8:90116324-90116346 GTGTAAAGCATAAACAGTGAAGG + Intergenic
1044599255 8:93987370-93987392 GAGAAAAGCAAAACCAAACATGG - Intergenic
1045279263 8:100735634-100735656 GTGCAATGGAAAACCACTAAAGG - Intergenic
1045524723 8:102931928-102931950 ACAAAAAACAAAACCACTGAGGG - Intronic
1045602086 8:103729025-103729047 GTGAAAAACAAAAAAACTAAAGG - Intronic
1045846896 8:106647674-106647696 ATGATAAGCCAAACCACTGATGG - Intronic
1046803640 8:118456050-118456072 GTGCAAAGGAAAGCCACTGAAGG - Intronic
1047541511 8:125771035-125771057 CTAAGAAGCAAAACCACAGAAGG - Intergenic
1047549417 8:125853476-125853498 GTAAAAAGCAAAAGATCTGATGG + Intergenic
1047922552 8:129650623-129650645 GTGAAATTCAAAACCTCTGGTGG - Intergenic
1049015404 8:139916449-139916471 GTGAAAAGCAAGGCCAAGGAGGG + Intronic
1050292895 9:4175218-4175240 ATTAAAAGCAAATGCACTGAAGG + Intronic
1052403135 9:28025941-28025963 GTGAAATGGAAAGCCACTGAAGG - Intronic
1053551419 9:39083188-39083210 AAGAAAAGAAAACCCACTGAAGG - Intronic
1053815534 9:41903305-41903327 AAGAAAAGAAAACCCACTGAAGG - Intronic
1054615062 9:67284135-67284157 AAGAAAAGAAAACCCACTGAAGG + Intergenic
1055890145 9:81115607-81115629 GTCAAGAGCAAAACCACTCAAGG - Intergenic
1056094484 9:83238248-83238270 GTGAAAAGACAAAACACTGAAGG - Intergenic
1056669969 9:88618576-88618598 GCTAAAAGTAAAAACACTGAAGG - Intergenic
1057572369 9:96214411-96214433 GTGGAAGGCAAAACCACTTACGG + Intergenic
1058504614 9:105655512-105655534 GTGAAATGGAGAGCCACTGAGGG + Intergenic
1058512944 9:105739432-105739454 GTGAAAAACAAAAATAGTGATGG + Intronic
1058622283 9:106896199-106896221 GAGAAAAACAAAAACAATGAGGG - Intronic
1059104347 9:111498872-111498894 GTCAAAGTCAAAACCAATGATGG + Intergenic
1060295842 9:122342551-122342573 GCTAAACGCAACACCACTGATGG - Intergenic
1062355796 9:136161672-136161694 GAGAAAAGCGAAACCACTCAGGG - Intergenic
1185749672 X:2600745-2600767 GTGGAAAGCAAAACCACAGATGG - Intergenic
1186307713 X:8281959-8281981 ATGAATCACAAAACCACTGAGGG - Intergenic
1186802722 X:13109689-13109711 GAGAAAAGAAAAACCACAGCCGG - Intergenic
1187438716 X:19297036-19297058 GTGAAAAGACAACCCACAGAGGG - Intergenic
1188295126 X:28437719-28437741 ATGGAAAGCAAAACAATTGATGG + Intergenic
1188296306 X:28453988-28454010 GTGAAAAGGCAATCCACAGATGG - Intergenic
1193592272 X:83404456-83404478 GTGAAGAGTGAAAACACTGAGGG - Intergenic
1197286586 X:124602338-124602360 ATGAAGTTCAAAACCACTGATGG + Intronic
1198093205 X:133352311-133352333 GAGACAACCAAAACTACTGAAGG + Intronic
1199085630 X:143627317-143627339 CTGAAAAGCAAGACAACCGATGG + Exonic
1200880935 Y:8210679-8210701 CTGAAAGACAAAACCACTCATGG + Intergenic