ID: 1126312226

View in Genome Browser
Species Human (GRCh38)
Location 15:47330515-47330537
Sequence GAGCTTGTCAGGGCGTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126312220_1126312226 8 Left 1126312220 15:47330484-47330506 CCATATTTTCCATGTTCTAAACT 0: 1
1: 0
2: 4
3: 43
4: 401
Right 1126312226 15:47330515-47330537 GAGCTTGTCAGGGCGTGCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 121
1126312222_1126312226 -1 Left 1126312222 15:47330493-47330515 CCATGTTCTAAACTTGGCTGAGG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1126312226 15:47330515-47330537 GAGCTTGTCAGGGCGTGCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126312226 Original CRISPR GAGCTTGTCAGGGCGTGCAG AGG Intronic
901519293 1:9770515-9770537 TAGCTGGTCGGGGGGTGCAGAGG - Intronic
903360303 1:22772791-22772813 GGGCTTTACAGGGCGTGCAGAGG + Intronic
903589389 1:24442661-24442683 AAGCTTGTCACTGAGTGCAGTGG + Intronic
906662098 1:47590348-47590370 GAGCTAGTGAGAGGGTGCAGTGG - Intergenic
907349194 1:53811850-53811872 GAGGTGGTGAGGGGGTGCAGTGG - Intronic
908562260 1:65318691-65318713 GAGCTTGTCAGGGCATGGGTGGG + Intronic
908714197 1:67053382-67053404 GAGGCTGTCAGCGGGTGCAGGGG + Intronic
913449975 1:118986632-118986654 GGGCTTGTCAGCGTGTGAAGCGG + Intronic
919750146 1:201032585-201032607 GTGCTTGGCAGGGTGTGCAAAGG + Intergenic
919795990 1:201321925-201321947 GAGCCTGTCGGGCCGGGCAGAGG + Intronic
1062880618 10:975014-975036 GAGCCAGGCAGGGCCTGCAGAGG - Intergenic
1062896081 10:1104346-1104368 GGGCTCCTCTGGGCGTGCAGAGG + Intronic
1064353535 10:14598527-14598549 GTGGTTGTCAGGGACTGCAGTGG + Intronic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1067079223 10:43203983-43204005 GAGCTGGTCAGAGAGTGCAGGGG - Intronic
1067946381 10:50691949-50691971 GCCCTTGTCAGGGGGAGCAGTGG + Intergenic
1070881696 10:79856950-79856972 GCCCTTGTCAGGGGGAGCAGTGG + Intergenic
1071648269 10:87373264-87373286 GCCCTTGTCAGGGGGAGCAGTGG + Intergenic
1072555645 10:96512407-96512429 GAGGTTTCCAGGGCGTGAAGGGG + Intronic
1074316401 10:112365341-112365363 GAGGTTGTGATGGCATGCAGTGG - Intergenic
1076737956 10:132467124-132467146 CAGCTTCTCAGGGCTTGCGGTGG - Intergenic
1077474404 11:2779564-2779586 GAGCTTGGCAGGGAGTGGCGGGG - Intronic
1080051041 11:27859449-27859471 GAGCTTGTCAGGTTGGGTAGGGG - Intergenic
1081925695 11:46826553-46826575 GTGCTTGTTTGGGCATGCAGTGG - Intronic
1083731470 11:64654659-64654681 GAGCCAGTCAGGTCTTGCAGAGG + Intronic
1088891839 11:114050736-114050758 GAGCGAGGCAGGGTGTGCAGGGG - Intergenic
1088909449 11:114179902-114179924 GAGCTTGTCATGGCTTCCACTGG + Intronic
1089560906 11:119342669-119342691 GAGGGTGTAAGGGTGTGCAGTGG - Exonic
1089832514 11:121341076-121341098 GAGCTTGTATGTGTGTGCAGTGG - Intergenic
1092511725 12:9163760-9163782 GAACTTCTCAGTGAGTGCAGAGG - Exonic
1095403643 12:41843231-41843253 TGGCCTGTCAGGGAGTGCAGGGG + Intergenic
1095982372 12:47980820-47980842 GAGCTTGTCAGGGAGGGAAATGG - Intronic
1099304347 12:80936731-80936753 GAGCTTGTGAGGGCGTCCTGGGG + Intronic
1099636233 12:85216172-85216194 GGGCCTGTCAGGGGGTGCGGGGG - Intronic
1101814137 12:108132099-108132121 GAAATTGTCAGGGAATGCAGTGG + Intronic
1104139945 12:125978187-125978209 GAGGTGGTCAGGGCAGGCAGGGG + Intergenic
1110754625 13:79157941-79157963 GGGCTTTTCAGTGCCTGCAGTGG - Intergenic
1110797770 13:79659693-79659715 GTGCTATTCAGGGCATGCAGAGG - Intergenic
1112269847 13:97958627-97958649 GAGCTGGACAGAGGGTGCAGAGG - Intronic
1115842242 14:37484994-37485016 GGGCTTGTCAGGGGGTGGAGGGG - Intronic
1116561567 14:46385865-46385887 GAGCTTGTCAGGGTGAGATGAGG + Intergenic
1118821571 14:69349422-69349444 GAGCCTGGCAGGACTTGCAGGGG - Intronic
1119380333 14:74224323-74224345 GAGTTTGTGATGGCTTGCAGAGG - Intergenic
1120507175 14:85367106-85367128 GGGCTTGTCAGGGGGTGTGGGGG - Intergenic
1124421775 15:29529205-29529227 GGGGTTGTGAGGGCGTGGAGGGG + Intronic
1126312226 15:47330515-47330537 GAGCTTGTCAGGGCGTGCAGAGG + Intronic
1127916427 15:63459154-63459176 GGGCTTGGCAGGCCGTGCATTGG + Intergenic
1128767303 15:70258986-70259008 GAGCAGGTCAGGCTGTGCAGAGG + Intergenic
1129253462 15:74320934-74320956 GAGCTTGGCTGGGTGGGCAGTGG + Intronic
1130062845 15:80581965-80581987 GAGCTTGTCCTGACGTGGAGTGG - Intronic
1138977918 16:62230540-62230562 GAGCTGGACAGGGGGTGGAGTGG - Intergenic
1139911459 16:70399924-70399946 GAGCCTGTCAGTGCCTGCAGAGG + Exonic
1141203648 16:81915789-81915811 GAGCTCCTCAGGGCAGGCAGGGG - Intronic
1141434748 16:83993692-83993714 GTGCCTGTCAGGGCACGCAGGGG + Intronic
1144095170 17:11893700-11893722 GGGCCTGTCAGGGGGTGGAGGGG + Intronic
1144778409 17:17796178-17796200 CAGTTTGTCTGGGGGTGCAGGGG - Exonic
1146492572 17:33292888-33292910 GAGCTTCTCAGGGCGTCCTGCGG + Exonic
1148860047 17:50600012-50600034 GGGCTTGGCAAGGCGGGCAGAGG - Intronic
1152723025 17:81932066-81932088 CAGGGTGTCAGGGTGTGCAGGGG - Intergenic
1152772946 17:82181290-82181312 GAGCTCGTCAGGGCGGCCGGCGG + Intronic
1152796330 17:82309357-82309379 GGGGTTGTCAAGGCGGGCAGAGG - Intergenic
1153273424 18:3345493-3345515 GACCTTGTCAGGGCATCCAGAGG - Intergenic
1153813522 18:8773242-8773264 CAGCATGGCAGGGGGTGCAGGGG - Intronic
1156448760 18:37254540-37254562 GAGCCTGGCGGGGCGGGCAGAGG - Intronic
1158392637 18:57056098-57056120 GAGGTTATCAGGGTGTGCAAGGG + Intergenic
1160370021 18:78364292-78364314 CAGCTTGTCAGGCTGTGCTGAGG + Intergenic
1160871773 19:1281022-1281044 GAGCTTGCGGGGGCGGGCAGTGG + Intergenic
1160962423 19:1729258-1729280 GAGCTCGTGAGGGTGTGCAAGGG + Intergenic
1161851348 19:6739588-6739610 GGGCGTGGCAGAGCGTGCAGGGG + Intronic
1163262300 19:16198402-16198424 GAGCCAGGCAGGGCGTCCAGGGG + Intronic
1163568856 19:18068435-18068457 GAGCTTCTCGGGGTGCGCAGAGG + Exonic
1164542180 19:29129300-29129322 GACCATGTGAGGACGTGCAGGGG + Intergenic
1165060945 19:33204966-33204988 GAGATTGACAGGGCGGTCAGGGG - Intronic
1165105612 19:33468191-33468213 GAGCTGGCCAGGGGGTGCACCGG - Intronic
1168296066 19:55377828-55377850 GCGCTGGTCTGGACGTGCAGCGG + Exonic
925570981 2:5312551-5312573 CAGCCTATCAGGGCATGCAGGGG + Intergenic
931307134 2:61040576-61040598 GGGCCTGTCAGGGGGTGGAGGGG + Intronic
932055448 2:68438635-68438657 GAGCTTGGGAGGGCGGTCAGGGG + Intergenic
932269206 2:70394467-70394489 GGGCCTGTCAGGGAGGGCAGGGG - Intergenic
934924115 2:98369825-98369847 GTGCCTGCCAGGGCTTGCAGGGG + Intronic
938686857 2:133746825-133746847 GGGCTTGTCAGTGGGTGAAGGGG - Intergenic
943191265 2:184681856-184681878 GAGCCTGTGAGGGCATGGAGGGG - Intronic
946233548 2:218307789-218307811 GAGCTTGTCAGAGAGGGGAGAGG + Intronic
946417995 2:219550216-219550238 GACCTTGGCAGGGAGTGAAGAGG - Exonic
1169305825 20:4489582-4489604 GATCTTGGCAGGGCTTGCTGTGG + Intergenic
1172288555 20:33758546-33758568 GAGCTTCACAGGGCCTGGAGAGG - Intronic
1173561001 20:44005685-44005707 GAGCCTGTCAGTGGATGCAGGGG + Intronic
1175725130 20:61312900-61312922 GAGCTTGCCTGGGATTGCAGGGG + Intronic
1180589166 22:16921544-16921566 GAGCCTGTCTGGGACTGCAGAGG + Intergenic
1184173812 22:42774779-42774801 GAGCCTGTGAGGGCGGGGAGGGG - Intergenic
1184885249 22:47341052-47341074 GAGGTTGGCAGAGCCTGCAGTGG - Intergenic
950419964 3:12892789-12892811 GAGGTTGTGGGGGGGTGCAGGGG - Intergenic
956021703 3:64940171-64940193 GAACTTGTGAGGTCCTGCAGAGG + Intergenic
958747305 3:98152639-98152661 GAGCCTGTCAGGGGGTGGAGGGG + Intergenic
959723315 3:109516104-109516126 GAGCTTGAAAGGGGGTGGAGTGG + Intergenic
965881012 3:173388113-173388135 GGGCCTGTCAGGGGGTGCAGGGG + Intergenic
971672892 4:29586508-29586530 GGGCTTGTCAGGGGGTGGGGGGG + Intergenic
974912724 4:68143061-68143083 GAGCCTGTCAGGGGGTGTGGGGG - Intergenic
984290767 4:177791096-177791118 GAGCTTGACAAGGCGTTCTGTGG - Intronic
984743834 4:183194025-183194047 GAGCCTGTCAGAAGGTGCAGTGG - Intronic
985143027 4:186862601-186862623 GAGGTGGTCTGGGTGTGCAGAGG - Intergenic
986365770 5:7029082-7029104 GGGCCTGTCAGGGGGTGGAGAGG + Intergenic
987137894 5:14916928-14916950 CAGCTTGTAAGTGCGTGCATTGG + Intergenic
987779802 5:22419305-22419327 GGGCCTGTCAGGGGGTGCAGGGG - Intronic
990688200 5:58332190-58332212 GTGGTTGTCAGGGCCTGCAGAGG + Intergenic
998252301 5:140561428-140561450 GATCTTGTCAGAGCGAGTAGAGG - Exonic
998884158 5:146676571-146676593 GATCTTTTCAGGGAGAGCAGAGG - Intronic
999933373 5:156458063-156458085 GAGCCTGTCAGAAGGTGCAGTGG + Intronic
1001871532 5:175160122-175160144 GAACTTGTCAGATGGTGCAGTGG + Intergenic
1002634434 5:180600127-180600149 GAGCTTGGCGGGGTCTGCAGGGG - Intergenic
1004881222 6:20010545-20010567 GAGGTTCTCAGGGCGAGGAGAGG - Intergenic
1007727251 6:43923982-43924004 GAGCATGGCAGGGCTGGCAGAGG - Intergenic
1008567224 6:52781252-52781274 GATCTTGGCAGAGCATGCAGAGG + Intergenic
1017202019 6:151764471-151764493 GCGCTTGTCAGGACGGCCAGTGG + Intronic
1017294282 6:152776144-152776166 GGGCCTATCAGGGGGTGCAGTGG + Intergenic
1019015256 6:168875545-168875567 GAGCGTGTCAGGAGGTGCTGGGG + Intergenic
1027184324 7:75961431-75961453 GAGCTTCTCAGGGCCAGTAGAGG - Intronic
1029202184 7:98846641-98846663 GAGCCTGTCAGGAAGGGCAGGGG - Exonic
1029330427 7:99849034-99849056 AGGCTTATCAGGGAGTGCAGCGG + Intronic
1033556171 7:142490094-142490116 GAGCATGCCAGGCCATGCAGTGG + Intergenic
1033558535 7:142509540-142509562 GAGCATGCCAGGCCATGCAGTGG + Intergenic
1038183185 8:25248020-25248042 GCGCATGTCAAGGCGTGAAGGGG + Intronic
1041818419 8:62001251-62001273 GGGCCTGTCAGGGAGTGAAGGGG - Intergenic
1042535993 8:69859846-69859868 GAGATTGTCAGGTGGTGCTGAGG + Intergenic
1048439103 8:134446846-134446868 GAGCTTGGCAGGGCTTGAACTGG + Intergenic
1048978997 8:139693044-139693066 GAGCTTGTCAGGTGGGGCTGGGG - Intronic
1049176393 8:141195274-141195296 GAGCGTGTCAGCACGTGCTGAGG + Exonic
1053303231 9:36966349-36966371 GGGCTTGTCTGGGCCTCCAGTGG - Intronic
1054822810 9:69540539-69540561 GTGGTTGTCAGGGGTTGCAGGGG - Intronic
1060431415 9:123554109-123554131 GAGCCTGCCAGGGTGTGCTGAGG - Intronic
1189910694 X:45807704-45807726 GTGGTTGTCAGGGGCTGCAGGGG + Intergenic
1190580954 X:51893064-51893086 GAGCTTGTGGGGGCGGGCAGGGG + Intronic
1191008635 X:55738158-55738180 GAGCTTATCAGAGAGTTCAGTGG - Intronic
1198080811 X:133237478-133237500 GTGGTTATCAGGGCATGCAGTGG + Intergenic