ID: 1126312367

View in Genome Browser
Species Human (GRCh38)
Location 15:47332474-47332496
Sequence ATACATAACCAGAAGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126312364_1126312367 9 Left 1126312364 15:47332442-47332464 CCTAATTGTCTGTTGGTGTTGTT 0: 1
1: 0
2: 0
3: 42
4: 509
Right 1126312367 15:47332474-47332496 ATACATAACCAGAAGGAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126312367 Original CRISPR ATACATAACCAGAAGGAACT TGG Intronic
902535223 1:17115864-17115886 ATACATAGAAAGAAGGAAGTAGG - Intronic
903015102 1:20356442-20356464 CTACATAACCAGGCTGAACTGGG + Intergenic
904657625 1:32061082-32061104 ATAAATAACCAGAAGGCATTAGG - Intergenic
907446293 1:54510080-54510102 ATAAAAAAGCAGCAGGAACTGGG + Intergenic
910333561 1:86103709-86103731 ATACATTGCCAGAAGAGACTGGG - Intronic
910469455 1:87536269-87536291 ATACATATCAAGAAAGAAATTGG - Intergenic
914436873 1:147668401-147668423 ATATATATCCTGAAGGCACTAGG - Intronic
914716253 1:150257374-150257396 ATATATAACAAGAAGGAATTAGG - Exonic
916567595 1:165994907-165994929 ATACATCAGCACAAAGAACTTGG + Intergenic
916975090 1:170067925-170067947 ATACATACCCAGAAAAAACCTGG + Intronic
919107471 1:193171434-193171456 ATCAACAACCCGAAGGAACTTGG - Intronic
923416821 1:233770511-233770533 ATACACATCCAGAAGGTACTAGG + Intergenic
1070206369 10:74266843-74266865 TTATATAATCAGAAGGAACTTGG + Intronic
1074899437 10:117803657-117803679 ATACCTAACCAGAGGGAATAGGG - Intergenic
1076410975 10:130250253-130250275 ATACACAATCAGAAGCCACTGGG - Intergenic
1080194734 11:29596021-29596043 ATACATTACCAATAGGATCTGGG - Intergenic
1082729276 11:56775239-56775261 ATTCTTATCCAGAAGGAATTAGG - Intergenic
1083542538 11:63523376-63523398 GTAGATAACCTCAAGGAACTTGG - Intergenic
1083841282 11:65305734-65305756 ATACATTCCCAGAAGGGACTTGG - Intergenic
1084359231 11:68658882-68658904 ATTCATACACAGAAGGGACTGGG - Intergenic
1084992225 11:72937720-72937742 ATACATAACCATGAGAACCTGGG + Intronic
1086527747 11:87748749-87748771 ACACATAACCAAGAGGGACTAGG - Intergenic
1087124331 11:94608125-94608147 GTCCATAACCAGAATGAACATGG + Intronic
1088374309 11:109123444-109123466 ATACATAAAGAGAAGGCACAGGG + Intergenic
1092339905 12:7666800-7666822 ATACAAAATGAGAAGGACCTTGG + Intergenic
1092696901 12:11182222-11182244 ATACAGAATCAAAAGGAACATGG + Intergenic
1096084027 12:48853111-48853133 TTAGATAACCAGAAGTATCTCGG + Intergenic
1098495424 12:71129522-71129544 ACACTTAACGACAAGGAACTGGG + Intronic
1098601780 12:72340077-72340099 AGACATACCCATAAGGAAGTGGG - Intronic
1103075885 12:117982269-117982291 ATAAATAAACAAAAGGAAGTTGG - Intergenic
1104383695 12:128330031-128330053 AGACATAACCAGAATGAAAAAGG - Intronic
1106343454 13:28853333-28853355 ATATGTAACCAGTAGGAACATGG - Intronic
1107099484 13:36574435-36574457 ATACACACGAAGAAGGAACTGGG + Intergenic
1107228450 13:38079456-38079478 ATTCATAACAAGAAGGATTTTGG + Intergenic
1107238815 13:38207669-38207691 ACAAATAACGAGAGGGAACTGGG - Intergenic
1107923372 13:45233379-45233401 ATAATTAACCAGAAGAAACATGG + Intronic
1108009092 13:45985436-45985458 ATACATATCCAGAAGAATCCCGG - Exonic
1109342496 13:61078963-61078985 ATACATATCCAGAAGCACTTAGG + Intergenic
1109528118 13:63603335-63603357 AAACAGAACCAGAAAGAAATTGG + Intergenic
1109836476 13:67863827-67863849 ATATTTAACCAGAAGGCAGTGGG + Intergenic
1114876801 14:26730499-26730521 ATACATAACTAAAAGGGTCTTGG - Intergenic
1115316602 14:32031475-32031497 CTTCCCAACCAGAAGGAACTTGG + Intergenic
1115695634 14:35895616-35895638 AATCAATACCAGAAGGAACTTGG - Intronic
1116174473 14:41450000-41450022 TTACTTAACCAGAGGGCACTTGG + Intergenic
1116477469 14:45358090-45358112 ATATAGAAGCAGAAGGAATTAGG + Intergenic
1116571447 14:46522112-46522134 CTACATGATCAGAAGGAAATAGG - Intergenic
1116724724 14:48548260-48548282 ATAAATAACCAGAATCAAGTGGG + Intergenic
1118093337 14:62507792-62507814 TGACATAACCAAATGGAACTAGG - Intergenic
1118879692 14:69815750-69815772 ATAGATAACCTCAAGGAGCTTGG - Intergenic
1122238682 14:100347500-100347522 TTCCACTACCAGAAGGAACTAGG + Intronic
1122354949 14:101117362-101117384 ATTCAGAGCCAGAAGGATCTGGG + Intergenic
1122569999 14:102690654-102690676 AGCAATAACCAGAATGAACTGGG - Intronic
1123840200 15:24240366-24240388 ATTCATAACCAGAGGTAACCAGG - Intergenic
1123845996 15:24302660-24302682 ATACATAACCAGACAGGACCAGG - Intergenic
1123865031 15:24510363-24510385 ATACATAACCAGACAGGACTAGG - Intergenic
1125401117 15:39304231-39304253 ATACATGCCCAGACAGAACTCGG - Intergenic
1126312367 15:47332474-47332496 ATACATAACCAGAAGGAACTTGG + Intronic
1126592093 15:50350839-50350861 TGACTTGACCAGAAGGAACTAGG - Intronic
1130765089 15:86862023-86862045 GTACACAAGCAGAAGGAACAGGG - Intronic
1133571835 16:7048552-7048574 ATAAAGAACCAAAAGGAGCTGGG - Intronic
1134388728 16:13798344-13798366 GTACATCACCAGAAGGTGCTTGG + Intergenic
1136096508 16:27960862-27960884 ATACACAGCCAGAAGGTTCTCGG + Intronic
1138004556 16:53320011-53320033 ATAAATAAATAGAAGGAGCTGGG + Intronic
1141355340 16:83340110-83340132 ATACAAAAGTAGAAGGAAATTGG - Intronic
1143127521 17:4653064-4653086 CTAAACAACCAGAAGGAACCAGG + Intergenic
1145019383 17:19417609-19417631 ATACATAAGCAGAGAGAACTTGG + Intergenic
1148056996 17:44805110-44805132 ATACATTATCAGAAGGAAGATGG + Exonic
1149758156 17:59205308-59205330 AAACATAACCAGATGCACCTTGG - Intronic
1149758305 17:59206645-59206667 AAACATAACCAGATGCACCTTGG - Intronic
1150657912 17:67052490-67052512 GTACATTTCCAGAAAGAACTAGG + Intronic
1151020355 17:70609289-70609311 ATACATAACAAGATGGTACAAGG + Intergenic
1151100717 17:71552575-71552597 ATACATCACCAAAAGGACCATGG - Intergenic
1152043031 17:77917356-77917378 ATACCAAACCAGGAGGAACACGG - Intergenic
1155928430 18:31681987-31682009 AGACATATCCAGAAGTAATTAGG - Intronic
1156031871 18:32722385-32722407 AAGCTTAACCAGAAGGAACCTGG + Intronic
1157486108 18:48088525-48088547 ATACATTAACAGAAGGAAACTGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1166970639 19:46565004-46565026 ATTCATGACCAGTGGGAACTGGG - Intronic
925960392 2:9009033-9009055 ATAGATAAACAGAAAGAACCTGG - Intergenic
927158849 2:20239801-20239823 TGCCAAAACCAGAAGGAACTGGG + Intergenic
928191268 2:29171404-29171426 ATACTTAACCAAAAGAAAGTTGG - Intronic
929863573 2:45699282-45699304 ACACATAACAAGAAGGCAGTGGG - Intronic
931170386 2:59797231-59797253 ATCAATAACCAGAATGAAATGGG + Intergenic
933293403 2:80462840-80462862 ATTCATAACAAGGTGGAACTGGG - Intronic
933917925 2:87015094-87015116 ATTGTTAACCAGAAGGAACATGG - Intronic
934005070 2:87754820-87754842 ATTGTTAACCAGAAGGAACATGG + Intronic
935004615 2:99059986-99060008 ATATATAGCCATAAGGAAATAGG - Intronic
935768031 2:106388860-106388882 ATTGTTAACCAGAAGGAACATGG + Intergenic
941060166 2:160837827-160837849 TTACATCACCAAAAGCAACTGGG + Intergenic
941268157 2:163390040-163390062 ATCCATAAGCAGCAGGAACCAGG - Intergenic
942000161 2:171638541-171638563 AGGCATACCAAGAAGGAACTGGG + Intergenic
943934400 2:193896833-193896855 AAACAAAACCAGAAATAACTAGG + Intergenic
948251396 2:236532876-236532898 TTACATTACCAAAAGGAATTAGG - Intergenic
1172905722 20:38367769-38367791 ATACATAACCAAAAGGTTCATGG + Intronic
1173117060 20:40254445-40254467 ATTCAGAAACTGAAGGAACTGGG - Intergenic
1173331447 20:42079130-42079152 ATTCATAGCCTGAAGGAACAGGG + Exonic
1174294559 20:49536339-49536361 ATATATAAGCAAAAGGAAATGGG + Intronic
1174893121 20:54419417-54419439 TTACATAACCAGCAATAACTTGG + Intergenic
1175128252 20:56768541-56768563 ATGCATAAGCAGAAGGCAGTGGG - Intergenic
1175151939 20:56941777-56941799 ATCCCTAACCAAAAGGATCTGGG + Intergenic
1175682159 20:60996859-60996881 TTAAATAATAAGAAGGAACTTGG + Intergenic
1175952240 20:62589585-62589607 ATGCTTTACCAGCAGGAACTGGG + Intergenic
1177827911 21:26104435-26104457 ATACATAAGCACAAAGAATTTGG + Intronic
1179426506 21:41283664-41283686 AGACACGTCCAGAAGGAACTTGG - Intergenic
1181445056 22:22964176-22964198 ATTCATAACCAGAATGTACAAGG - Intergenic
949242389 3:1888511-1888533 TTACACAACCAGAAAGAACAAGG - Intergenic
949242895 3:1892379-1892401 TTACAGAACCAGAAAGAACCAGG - Intergenic
953054469 3:39377003-39377025 AAGCAGAACCTGAAGGAACTGGG + Intergenic
955824519 3:62931334-62931356 ATCCTAAAGCAGAAGGAACTTGG - Intergenic
959463235 3:106652080-106652102 ATACTGAACCAGGAGGAAATTGG + Intergenic
959584672 3:108015023-108015045 ATAAAGAACAAGAAGAAACTTGG + Intergenic
960898877 3:122534189-122534211 AAACTTAACCAGAAGAAATTAGG + Intronic
961608137 3:128113086-128113108 CTACAGAACCACCAGGAACTAGG + Intronic
962342723 3:134598667-134598689 AGACACATCCAGAAGGGACTGGG + Intronic
962868538 3:139468069-139468091 AACCATAACCAGAAGAAACAGGG + Intronic
963353517 3:144181329-144181351 CTAAATAGACAGAAGGAACTTGG - Intergenic
963613196 3:147498851-147498873 ATAAATAACAAGAAGGAGTTGGG - Intronic
963976914 3:151490708-151490730 ATAAATAACAAGAAGAATCTTGG + Intergenic
964471625 3:157063157-157063179 ATGAATAGCCAGTAGGAACTTGG + Intergenic
964863851 3:161231904-161231926 ATGCATAACCATATGGAAATTGG + Intronic
965013160 3:163123532-163123554 CTACATAAGCAGAAGGAAAAGGG - Intergenic
965441676 3:168722406-168722428 ATACATCACCACATGGAGCTAGG + Intergenic
966189323 3:177257879-177257901 ATAGAAAACAAGAAGGAAGTTGG - Intergenic
967304125 3:188044310-188044332 ATGCCTACCTAGAAGGAACTTGG + Intergenic
967919033 3:194600787-194600809 ATAGATTACCAGAAGGACCAGGG + Intronic
971115292 4:23639298-23639320 ATACAAAAGCAGTATGAACTCGG + Intergenic
971777399 4:30984479-30984501 ACACATAAACATAAGGAAGTTGG + Intronic
972766990 4:42160186-42160208 ATAAAAACCCAAAAGGAACTGGG - Intergenic
973653247 4:53018493-53018515 AGAAATCACCAGAAGGAAATTGG - Intronic
973700900 4:53536137-53536159 TTACATAAGCAGGAAGAACTGGG + Intronic
974115537 4:57575000-57575022 ATACAGAGCCAGAAAGACCTGGG - Intergenic
974319632 4:60330081-60330103 AAACATAAGCAAAAGTAACTTGG + Intergenic
974875645 4:67700601-67700623 AACTATTACCAGAAGGAACTTGG - Intronic
977296218 4:95212592-95212614 ATGCAGAAGCAGAAAGAACTGGG - Intronic
977876374 4:102155204-102155226 AAACATAAGCAGAAGTAGCTGGG + Intergenic
978742526 4:112153487-112153509 AAACATAACTAGTAGGAACAAGG - Intronic
979389514 4:120111322-120111344 ATACATAATCAGAAGAATCAAGG - Intergenic
980660099 4:135846760-135846782 ATATAGAACCAAAAAGAACTAGG + Intergenic
983223101 4:165061645-165061667 TAACATAACCAGAAGGATCTGGG + Intergenic
989986766 5:50709391-50709413 ATAGATAACCAGAATATACTTGG - Intronic
990053059 5:51531856-51531878 ATAAATAACCATAATGACCTTGG + Intergenic
990889099 5:60629688-60629710 ACAAATAACCAGATGGAAATTGG - Intronic
991981643 5:72237694-72237716 ATACTTCACCAGAAGGAAACAGG + Intronic
993785670 5:92132270-92132292 AAAAATAACCAGTAGGTACTAGG - Intergenic
994187195 5:96828181-96828203 ATAGAAAATCAGAAGGCACTAGG - Intronic
996223141 5:120957440-120957462 ATCAATAACCAGAAGAACCTTGG - Intergenic
996988135 5:129593295-129593317 GCACATGACCAGAAAGAACTTGG - Intronic
997656870 5:135561614-135561636 ACACATGACCAGAAGGTTCTGGG - Intergenic
997758139 5:136419742-136419764 AGACATCACAAGAAGGAACTCGG + Intergenic
1000408074 5:160909774-160909796 ATACATTAGGAGAAAGAACTCGG + Intergenic
1001690493 5:173629308-173629330 CTAAATAACAAGAAGGAGCTGGG + Intergenic
1003007096 6:2392267-2392289 ACACAGGACCAGAAGTAACTCGG - Intergenic
1005484655 6:26288254-26288276 ATAGATAACCTTAAGGAACACGG + Intergenic
1005485583 6:26296086-26296108 ATAGATAACCTTAAGGAACACGG + Intergenic
1007490063 6:42213677-42213699 ATAAACATCTAGAAGGAACTTGG - Intronic
1008787611 6:55188213-55188235 AAACTTAACCAAAAGGGACTTGG + Intronic
1008915911 6:56786512-56786534 AAACAAAACCAAAAGGTACTGGG - Intronic
1010573166 6:77502790-77502812 ATATATATCCTGAAGAAACTAGG + Intergenic
1011602614 6:89074108-89074130 ATACATAATGATAAGAAACTAGG + Intergenic
1017119980 6:151015097-151015119 ATAAACAAACAGAAAGAACTGGG - Intronic
1018128875 6:160709040-160709062 ATTGTTAACCAGAAGGAACATGG + Intronic
1023207973 7:37771471-37771493 CTACTTAGCCAGAAGGAAATGGG + Intronic
1028788376 7:94823456-94823478 ATACAGAACCACAAAGATCTAGG + Intergenic
1029907628 7:104107499-104107521 ATAAATAACTAGAGGGCACTAGG - Intergenic
1030889800 7:114985594-114985616 AAAAATAACCAGTAGGCACTAGG - Intronic
1033007333 7:137580951-137580973 ATATATATTCAGAAGGCACTAGG + Intronic
1033888206 7:145974687-145974709 AGACAAACCCAGAAGAAACTTGG + Intergenic
1035275393 7:157745240-157745262 AGACATACACAGAAGGACCTGGG - Intronic
1036458400 8:8929939-8929961 ATGCCCAACCAGAAGGACCTGGG - Intergenic
1040614044 8:49017371-49017393 ATAAATAACCTGATGGATCTGGG - Intergenic
1041273704 8:56135534-56135556 ATACATAACCTTAAGAAATTAGG - Intergenic
1042988201 8:74606715-74606737 AAAAATAACCAGTAGGTACTAGG + Intronic
1043025886 8:75068093-75068115 ATACATAACAGGAAGAAATTAGG + Intergenic
1044952329 8:97446464-97446486 ACAAATAACCAGCAGGAACCGGG - Intergenic
1045682533 8:104678278-104678300 ATATATAATCAGAAAGTACTTGG - Intronic
1045863637 8:106840476-106840498 AAACAAAACCAGTAGGAAGTAGG + Intergenic
1047680134 8:127246170-127246192 ATACAGAACCAGTAGGATTTGGG + Intergenic
1048246042 8:132801068-132801090 GTAGAAAACCAGAAGGAACAAGG - Intronic
1049060864 8:140275107-140275129 ATACATTACAAGAGTGAACTAGG - Intronic
1049591070 8:143462901-143462923 AAACACACCCAGAAGGAACCAGG + Intronic
1050644572 9:7705045-7705067 ATACATAACCAAAAGAATCCGGG - Intergenic
1052295761 9:26894753-26894775 ATACAGAACCAGAGGGAAGAGGG - Intergenic
1052523277 9:29578916-29578938 AGACATAACCACAAGGGACCTGG + Intergenic
1056303073 9:85261892-85261914 ATACAAAACCAAAATGAGCTGGG + Intergenic
1056336546 9:85574628-85574650 ATATATAACCAGAAGGATACTGG + Intronic
1057543561 9:95999665-95999687 AAACAGAAAGAGAAGGAACTGGG - Intronic
1057567641 9:96179398-96179420 ATACATAAATAGAAGAAAATGGG + Intergenic
1058255601 9:102758801-102758823 ATACATAAACATAAAAAACTTGG + Intergenic
1058810623 9:108635348-108635370 ACACATAACCAGATGGAATGTGG - Intergenic
1186663751 X:11697459-11697481 ATACATACTCAGAAGATACTTGG - Intergenic
1189730644 X:44016734-44016756 ATACAGAACCAAATGAAACTTGG + Intergenic
1191792967 X:64990695-64990717 ATACAGAAAGAGAAGGAACAGGG - Intronic
1193257047 X:79361626-79361648 AAAAATAACCAGTAGGTACTAGG - Intronic
1196569335 X:117247436-117247458 ATACATAGCTAGAAAGAACCAGG - Intergenic
1197883404 X:131192808-131192830 ATTCATAACCTGAAGAAATTTGG + Intergenic
1197975917 X:132165776-132165798 GTACATAACCACAATGAATTTGG - Intergenic