ID: 1126313679

View in Genome Browser
Species Human (GRCh38)
Location 15:47344579-47344601
Sequence CCTGAGAACTTCAGCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126313679_1126313681 8 Left 1126313679 15:47344579-47344601 CCAAGGTGGCTGAAGTTCTCAGG 0: 1
1: 0
2: 3
3: 20
4: 234
Right 1126313681 15:47344610-47344632 CTTGAAAAGAGAAAGCCACATGG 0: 1
1: 0
2: 4
3: 39
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126313679 Original CRISPR CCTGAGAACTTCAGCCACCT TGG (reversed) Intronic
904436878 1:30504818-30504840 CATGAGAACTGCAGCCAGCAAGG + Intergenic
905348378 1:37327432-37327454 CATCAGAATTGCAGCCACCTGGG - Intergenic
905933330 1:41805259-41805281 CCTGGCAACTTCCGCCTCCTGGG - Intronic
908248918 1:62249904-62249926 CCTGAGCAGTCCACCCACCTTGG + Intronic
909784678 1:79596116-79596138 CCTGCCAACTCCAGCCAGCTAGG + Intergenic
910957737 1:92725064-92725086 CCTGTGAACTCTAGACACCTTGG - Intronic
912550335 1:110481302-110481324 CCTGAGATCTTCACCCACAAAGG - Intergenic
913472878 1:119207424-119207446 CCTGTGAGCTTCAGCTGCCTTGG + Intergenic
914244395 1:145874949-145874971 CAGGAGCAGTTCAGCCACCTCGG + Exonic
914314594 1:146498270-146498292 CCTGGAAACTTCATCCACGTTGG + Intergenic
914499757 1:148235118-148235140 CCTGGAAACTTCATCCACGTTGG - Intergenic
914781663 1:150791177-150791199 CCTGAGAATTTCAAACTCCTAGG - Intergenic
914804628 1:150983145-150983167 CAGGAGATCCTCAGCCACCTGGG + Exonic
914992424 1:152510594-152510616 CCTGAGAACTGCAGGCCTCTAGG - Intergenic
916586155 1:166152248-166152270 CCTGAGAACAACAACCACCACGG - Intronic
917602937 1:176595544-176595566 CTTGCGCACATCAGCCACCTGGG - Exonic
918093484 1:181316716-181316738 TCTGAGGACTTGACCCACCTGGG + Intergenic
918434064 1:184492905-184492927 CTTGAGAAAATCAGCAACCTGGG - Intronic
921577690 1:216855976-216855998 CCTGATAGTTTCAGCCAGCTTGG + Intronic
921639215 1:217532246-217532268 TCTGAGAGTTTCTGCCACCTAGG - Intronic
922708284 1:227804849-227804871 CCTGAGAACTCTAGTCATCTTGG + Intergenic
1064377056 10:14806321-14806343 CCTGACAACCTCTGCCTCCTGGG - Intergenic
1064988452 10:21234678-21234700 CCAGAGAACCTCAGCCGACTGGG + Intergenic
1065642079 10:27793595-27793617 TCTAAGATCTTCAGCCTCCTAGG - Intergenic
1068587695 10:58817663-58817685 CCTGAGCTCTTCAGCAAACTGGG + Exonic
1069773300 10:70912764-70912786 GCTGAGAAAGCCAGCCACCTGGG - Intergenic
1069905436 10:71729510-71729532 CCTGGGAACTTCCGTCCCCTAGG - Intronic
1069967758 10:72135570-72135592 CCTGAGAGCTTCAGCTAACCTGG - Intronic
1070288089 10:75098245-75098267 CCTGAGAGCCACAGCCATCTGGG - Intronic
1070546076 10:77453676-77453698 CCTGTGAATTCCAGCCTCCTTGG - Intronic
1070676304 10:78413929-78413951 CCTGTGAACTCTCGCCACCTGGG - Intergenic
1070778991 10:79126740-79126762 CCTCTGAGCTTCAGGCACCTGGG + Intronic
1071895263 10:90059708-90059730 CCTGACTGCCTCAGCCACCTAGG - Intergenic
1072638357 10:97192352-97192374 CATGGGAACCTGAGCCACCTTGG + Intronic
1074563837 10:114558527-114558549 CCTGAGAAATTCAGCCCTCATGG - Intronic
1076020877 10:127071980-127072002 CCTGAGCACTGAAGCCACCATGG - Intronic
1077379436 11:2222298-2222320 CCTGCAAACTCTAGCCACCTTGG - Intergenic
1079486098 11:20937363-20937385 CCTCAGAACCTCAGCCACAATGG - Intronic
1083241631 11:61392819-61392841 CTTGAGACCTTCAGGCACCCAGG - Intronic
1083483578 11:62966597-62966619 CCTGTGAACTCTTGCCACCTGGG - Intronic
1084730599 11:71070881-71070903 CCTGAGAGCCCCAGCCAGCTTGG + Intronic
1084857166 11:71996686-71996708 GCTGAGGCCTTCAGCTACCTGGG - Exonic
1086122855 11:83318311-83318333 CCTGAGAAAATCAGCACCCTGGG - Intergenic
1087794015 11:102436656-102436678 CCTAAGAACTTCATACATCTGGG + Intronic
1088669707 11:112129134-112129156 CCTCAGAACTTCAGAGAGCTTGG + Intronic
1088761920 11:112939004-112939026 TCTAAGAACTCTAGCCACCTTGG + Intergenic
1089587214 11:119517876-119517898 CCTGAGCTCTTCAGCCATCATGG + Intergenic
1090892503 11:130937540-130937562 TCTGTGAACTGCAGCCATCTTGG + Intergenic
1093986027 12:25534518-25534540 CTTGTGACCTCCAGCCACCTTGG - Intronic
1096105625 12:48995684-48995706 CCTGAGAATTTCTCCCATCTTGG - Exonic
1096173999 12:49499602-49499624 CCCCAGAATTTCAGCCATCTTGG + Intronic
1096189355 12:49605255-49605277 CCTGGGATATTCAGCAACCTGGG - Intronic
1096521000 12:52184477-52184499 GCTGAGAACTTCAGCCTTTTAGG + Intronic
1097936192 12:65254739-65254761 CCTGTGAACTCTAGCTACCTTGG + Intergenic
1098410705 12:70180424-70180446 CCTGAGAACTTCAGGCAGTAAGG - Intergenic
1098468237 12:70813754-70813776 CCTGAGAATTCTAGCCTCCTTGG - Intronic
1098793687 12:74861166-74861188 CCTGATCACTTCAGCCAAGTTGG - Intergenic
1103043002 12:117711415-117711437 CCAGACAGCTTCAGCCACATTGG - Intronic
1104508997 12:129358877-129358899 TCTGGGTAGTTCAGCCACCTGGG - Intronic
1106223008 13:27762502-27762524 TCTGTGAACTCCAGCTACCTTGG - Intergenic
1107551309 13:41478875-41478897 CAGGAGAACTTCCCCCACCTAGG - Intergenic
1108861745 13:54869019-54869041 CCTGAGAACTCTATCCTCCTTGG + Intergenic
1110040159 13:70744752-70744774 CCTGTGAACTACAGCCTCCTTGG + Intergenic
1110247934 13:73348109-73348131 CCTGAGAACTCTAGCCACCTTGG - Intergenic
1111547481 13:89760822-89760844 CCTGGAAACTTCAGCAGCCTTGG + Intergenic
1113849685 13:113410934-113410956 TCTGAGAAGTTCAGCCTCCTGGG - Intergenic
1115366516 14:32563574-32563596 CCTTCCACCTTCAGCCACCTTGG + Intronic
1115938329 14:38580262-38580284 CCTGAGAATTCTAGCAACCTTGG - Intergenic
1117036436 14:51734431-51734453 CCTGTGAACTCTGGCCACCTTGG - Intergenic
1117272649 14:54160757-54160779 CCTGAGAACTCCAGCCACCCTGG + Intergenic
1118508268 14:66440905-66440927 CCTGCAAACTCTAGCCACCTTGG + Intergenic
1119998485 14:79278516-79278538 CCAGGGGACTTCACCCACCTGGG + Intronic
1121830091 14:97044156-97044178 CCTCCGAACTTCAGGCCCCTGGG - Intergenic
1122180576 14:99951341-99951363 CCTGAGACTTGCAGCCAGCTGGG + Intergenic
1122227837 14:100290216-100290238 CCTGAGAGATTCAGCCACCCAGG + Intergenic
1124228553 15:27919202-27919224 GCTGAGGACTTCAGCAACTTGGG + Intronic
1125071116 15:35554328-35554350 CCTTAGAACTTCAGTCCCCCAGG + Intergenic
1125526316 15:40377624-40377646 CCTGAGCACTCTAGCCAGCTTGG - Intergenic
1125987849 15:44072894-44072916 CTTGAGAAATTCTCCCACCTTGG - Intronic
1126313679 15:47344579-47344601 CCTGAGAACTTCAGCCACCTTGG - Intronic
1127412018 15:58718827-58718849 TCTGTGAACTCCAGCCACTTTGG + Intronic
1128395888 15:67225137-67225159 CCTGGGAACTTTAGTCACCTGGG - Intronic
1128463429 15:67888740-67888762 CCTGACTACTGCAGTCACCTGGG + Intergenic
1128870101 15:71148348-71148370 CTTGAGAACTCCAGACACCTAGG - Intronic
1131506298 15:93022701-93022723 CCTGTGAACTCTGGCCACCTTGG + Intronic
1132216115 15:100062958-100062980 ACTGAGAACTCCAACCACCTTGG + Intronic
1132565785 16:622037-622059 CTTGGGAGCTTCAGCCACATGGG + Intronic
1133081961 16:3328917-3328939 CCTGTGCACATCAGCTACCTTGG - Intergenic
1134343719 16:13369849-13369871 TCAGAGAACTTAAGCAACCTGGG - Intergenic
1135051423 16:19196069-19196091 CCTGTGACCTTCTGGCACCTGGG - Intronic
1135080249 16:19427974-19427996 CCTGTGAGCTTCACCCACCTTGG + Intronic
1135877606 16:26217684-26217706 ACTGTGAATATCAGCCACCTGGG + Intergenic
1136487970 16:30585415-30585437 CGGGAGACCTTCGGCCACCTGGG - Exonic
1137855515 16:51790827-51790849 ACTGAAAACTTCTGCCTCCTGGG + Intergenic
1139292520 16:65871441-65871463 CCTGTGTACATCAGCCATCTGGG - Intergenic
1139839041 16:69863404-69863426 CCTCAGGACTTCACCCGCCTCGG - Intronic
1142111987 16:88337749-88337771 CCTGACACCATCAGCCACCAGGG - Intergenic
1142149788 16:88507627-88507649 CCTGAGAACACCAGCCCCCATGG + Intronic
1142275005 16:89113786-89113808 CCGCAGAACTGCAGCCATCTTGG - Intronic
1142994860 17:3754631-3754653 GCTGAGTACTACAGCCTCCTGGG - Intronic
1146892535 17:36515239-36515261 CCAGAGACCTGCAGCCACCTTGG - Intronic
1148317965 17:46721004-46721026 CCTGGGATCTTCAGACAACTGGG - Intronic
1149804452 17:59602140-59602162 CCTGTGAATTCTAGCCACCTTGG + Intronic
1150872097 17:68923742-68923764 CCTTAGAAGTTCAGCAACCTGGG + Intronic
1152254715 17:79231150-79231172 TCTTATAACTCCAGCCACCTTGG - Intronic
1152476205 17:80519987-80520009 CCTGAGAACATCAGCTCCCTTGG - Intergenic
1152633360 17:81420530-81420552 CCCGAGGACCTGAGCCACCTGGG + Intronic
1154184074 18:12166180-12166202 TCTGAGAACTTCCGAAACCTGGG - Intergenic
1156699914 18:39813799-39813821 CATGAGAACTTCCCCAACCTAGG - Intergenic
1157899046 18:51495997-51496019 CCTGACAGCTTCAGTCACTTTGG - Intergenic
1158117826 18:54016313-54016335 CCTGTGAACTCCAGCCACATTGG + Intergenic
1161034949 19:2079380-2079402 CTTGAGACCTTCTTCCACCTAGG - Intronic
1161732980 19:5973531-5973553 CCTGAGCACTACAGACATCTGGG - Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1163438885 19:17311596-17311618 TCTGTGAGCTTCAGCCACCCTGG + Intronic
1164844716 19:31422134-31422156 CCTGCCAATTTCAGCCCCCTTGG + Intergenic
1166744834 19:45136660-45136682 CCTGAGCACTTCCTCCTCCTTGG - Intronic
1168362569 19:55754645-55754667 CCTTGGAACTTCAGCATCCTTGG - Intergenic
926646194 2:15292216-15292238 CTTGAGATCTTGGGCCACCTTGG + Intronic
930711414 2:54554334-54554356 TCTGTGAACCTCAGCTACCTTGG + Intronic
931259481 2:60604816-60604838 CCTGGGAACCTCAGCCGTCTTGG - Intergenic
933093927 2:78154679-78154701 CTTGATAACATCAGCCACTTTGG + Intergenic
935148353 2:100411940-100411962 CCCCAGAACTCCAGCCACATGGG - Intronic
936117098 2:109711161-109711183 AGTGAGAACTTCAGCCGCCCCGG + Intergenic
936469127 2:112782474-112782496 CCTGAGAACTGGAGTCTCCTGGG - Intronic
936604719 2:113938810-113938832 CCTACAAACTTCAGCCACTTTGG + Intronic
937801309 2:126083453-126083475 ACTGAGATCTTAAGGCACCTTGG - Intergenic
942051216 2:172142799-172142821 CCTCAGGAGTTCACCCACCTCGG + Intergenic
947481268 2:230502114-230502136 CCTCAGAACTCCATCCACCTTGG + Intronic
947853733 2:233309157-233309179 CCTGGCAACTTCTACCACCTTGG - Exonic
948124631 2:235555739-235555761 CCTGAGCACTTCAGCCAACCAGG - Intronic
1168975083 20:1958827-1958849 CCTGTGAACTCCAGACACCTTGG - Intergenic
1171471522 20:25375773-25375795 CCGGGTAAATTCAGCCACCTTGG + Intronic
1172639578 20:36432635-36432657 CCAGAAGACCTCAGCCACCTTGG + Exonic
1173257070 20:41401367-41401389 CTTGAGAATTTCAGCTACCCTGG + Intergenic
1174879342 20:54261383-54261405 CCTCTGAGCTTTAGCCACCTTGG + Intergenic
1175588360 20:60165933-60165955 GCTGAGAGCTTCAGACACATTGG + Intergenic
1176345744 21:5745001-5745023 CATGAGAACTTCCCCAACCTGGG - Intergenic
1176352558 21:5865585-5865607 CATGAGAACTTCCCCAACCTGGG - Intergenic
1176499083 21:7579454-7579476 CATGAGAACTTCCCCAACCTGGG + Intergenic
1176540065 21:8143071-8143093 CATGAGAACTTCCCCAACCTGGG - Intergenic
1176559016 21:8326116-8326138 CATGAGAACTTCCCCAACCTGGG - Intergenic
1177208284 21:18036440-18036462 CCTGTGAACTCTAGCTACCTTGG + Intronic
1183655554 22:39182633-39182655 CCTTAGACATTCAGCCAACTAGG + Intergenic
1184958576 22:47911147-47911169 CCTGAAAATTCCAGACACCTTGG - Intergenic
1185355445 22:50366751-50366773 CCTGTGAACTCGAGCTACCTTGG + Intronic
1203245012 22_KI270733v1_random:59430-59452 CATGAGAACTTCCCCAACCTGGG - Intergenic
950114947 3:10444691-10444713 CCTGACACCTGCACCCACCTCGG - Intronic
950960503 3:17100670-17100692 CCTGAAAACTCTAGCCACCTTGG - Intergenic
952647427 3:35678286-35678308 CTTGAGAACTTCATTCAACTTGG + Intronic
952728541 3:36615394-36615416 CCTGAAAACTCCATCCACCTTGG + Intergenic
952805643 3:37348663-37348685 TCTCAGAACTTTAGCTACCTTGG + Intronic
953390616 3:42531691-42531713 CCTGAGCACTTTAGCAACCCCGG - Intronic
954422601 3:50426530-50426552 CCTCTGAACTTCAGCCACTAGGG + Intronic
954493497 3:50930606-50930628 CCTGAGCACTGGAGCCACCAAGG - Intronic
954871883 3:53773518-53773540 GCAGAGATCTACAGCCACCTGGG - Intronic
955416208 3:58694320-58694342 CCAGAGGCCTTCAGTCACCTAGG + Intergenic
956661456 3:71602359-71602381 CCTGTGAGTTTCAGCCACCTTGG - Intergenic
956975678 3:74575884-74575906 TCTGAAAACTTTACCCACCTGGG - Intergenic
958867552 3:99518738-99518760 ACTTATAACTTCAGCGACCTTGG - Intergenic
959747458 3:109793470-109793492 CAAGAGAAATTCATCCACCTTGG - Intergenic
963054167 3:141171046-141171068 CCTGTGAACTCTAGCCACCTTGG + Intergenic
965957763 3:174391131-174391153 TCTGAAAACTGCAGCCACGTTGG - Intergenic
966088540 3:176101711-176101733 CATGACAACTTCTGCCTCCTAGG - Intergenic
966640813 3:182187660-182187682 CCTGTGAATTCTAGCCACCTTGG + Intergenic
967885438 3:194330517-194330539 GCTGACAACTTCACCCACGTGGG + Intergenic
968198177 3:196727972-196727994 AATGAGAACTTCAGACTCCTTGG - Exonic
968359678 3:198138299-198138321 CCTGAGACCTTCAGTCACAATGG + Intergenic
968685443 4:1954926-1954948 CCTGGGCACTGCAGGCACCTGGG - Intronic
968736106 4:2297304-2297326 CGGGAGAGCTGCAGCCACCTCGG + Intronic
968982639 4:3858743-3858765 CTTGAGAAATACATCCACCTGGG + Intergenic
972372851 4:38442297-38442319 CCTGTGAACTCCAGCTATCTTGG + Intergenic
973154326 4:46931013-46931035 CCTGTGAACTCTAGCCATCTTGG - Intronic
976666511 4:87599894-87599916 CCTGGGAAATTCCGTCACCTAGG + Intergenic
977234780 4:94494975-94494997 CCTGAGCAATCCACCCACCTTGG + Intronic
978393157 4:108248842-108248864 CCTGTGAATTCTAGCCACCTTGG - Intergenic
979570989 4:122224505-122224527 CCTGAGTACTTCATCCACAGGGG - Exonic
985069264 4:186152052-186152074 CCAGAGAACTTCCACCACCAAGG - Intronic
985520757 5:373113-373135 GCGCAGAACCTCAGCCACCTTGG - Intronic
991941565 5:71858036-71858058 CCTGAAAACTCCAGCCACCTTGG + Intergenic
995114027 5:108458891-108458913 TCTGAGAATTTCAGACACATAGG + Intergenic
995169302 5:109088830-109088852 CTTGATAACTTCATCCATCTGGG - Intronic
995509119 5:112890491-112890513 CCTGTGGTCTTCAGCTACCTGGG - Intronic
996204549 5:120716257-120716279 CCTGAGAAAATCAGTCACATAGG - Intergenic
997640005 5:135442826-135442848 CCTGAGAAATGCAGCCTCCAGGG - Intergenic
999959011 5:156734431-156734453 CATGAGAACTTCCCCAACCTAGG - Intronic
999983085 5:156976519-156976541 AGTGGGAACTTCAGCAACCTGGG + Intergenic
1000245709 5:159446981-159447003 CCTGAGAACTTCTGCCTGCAGGG + Intergenic
1001407889 5:171488782-171488804 CCTGGTCACTTCTGCCACCTTGG - Intergenic
1001677964 5:173534263-173534285 CCAGAGCAGTTCAGCCATCTAGG - Intergenic
1002605535 5:180380768-180380790 TCTGAGGACTGCAGCCTCCTGGG - Intergenic
1004536955 6:16512163-16512185 CCTCAGAAGTTCTGCCACCACGG + Intronic
1004765019 6:18716079-18716101 CCTGAGGACTTCAGCCATAAAGG - Intergenic
1005278047 6:24241105-24241127 CCCATGACCTTCAGCCACCTGGG + Intronic
1006591110 6:35158377-35158399 CCTGAAAACTCTAGCTACCTTGG + Intergenic
1007055386 6:38878030-38878052 CCTGCAAATTCCAGCCACCTTGG - Intronic
1010785765 6:79999003-79999025 CCTGTGAACTTCACCTGCCTTGG + Intergenic
1010832739 6:80551114-80551136 CCTGGGGACCTCCGCCACCTGGG + Intergenic
1011114987 6:83879790-83879812 CCTGAGAACCTCAGACACAAGGG - Intronic
1011701691 6:89960981-89961003 CCTGAGAACTGGCGACACCTTGG + Intronic
1012958378 6:105595239-105595261 CCACAGAAATTCAACCACCTTGG + Intergenic
1013247050 6:108296903-108296925 CCATATAACTTCAGCAACCTTGG - Intronic
1013592276 6:111629273-111629295 CCTGGGCACTTCACTCACCTTGG - Intergenic
1013777065 6:113690124-113690146 CCTCAGGTGTTCAGCCACCTCGG - Intergenic
1015676087 6:135750939-135750961 CCTGACCACTCTAGCCACCTTGG - Intergenic
1017748215 6:157466105-157466127 CCTGAGAATTTCTTCTACCTTGG + Intronic
1019397810 7:832044-832066 TGTGAGAGCTTCAGCCATCTAGG + Intronic
1020437691 7:8183369-8183391 CCTGAGCAATGCAGCCACATTGG + Intronic
1021105488 7:16634472-16634494 CCTGGGAACTTAAGCCAACTTGG - Intronic
1022123464 7:27333113-27333135 CCTGTGTTCTTTAGCCACCTTGG + Intergenic
1022555268 7:31288194-31288216 CCTAAGAACTGTAGCTACCTTGG + Intergenic
1024181763 7:46902464-46902486 CCTGGGAACTCTAACCACCTTGG - Intergenic
1024286618 7:47763299-47763321 CATGAGAAATTCTACCACCTGGG + Intronic
1024433709 7:49323575-49323597 CCTTAGATCTCCAGCCTCCTAGG - Intergenic
1024821366 7:53334378-53334400 CCTGAGAAATGAAGCCACATGGG + Intergenic
1025722803 7:64031864-64031886 ACCCAGAACTTCACCCACCTCGG + Intronic
1026317107 7:69236661-69236683 CACGAGAACTACATCCACCTTGG - Intergenic
1026377489 7:69766611-69766633 ACTGAGAACTTCACTTACCTAGG - Intronic
1027336048 7:77151769-77151791 CCTGAGATGTGCATCCACCTGGG + Intronic
1029074117 7:97922829-97922851 CCACTGCACTTCAGCCACCTGGG - Intergenic
1029779739 7:102719327-102719349 CCTGAGATGTGCATCCACCTGGG - Intergenic
1030887349 7:114954726-114954748 CCTGATACCTTAAGCCATCTTGG + Intronic
1032076598 7:128838926-128838948 CTTAGGAACTCCAGCCACCTTGG - Intronic
1033303154 7:140204255-140204277 CCTGCAAATTCCAGCCACCTTGG + Intergenic
1035856106 8:2978210-2978232 CCAGAGCACTTCGCCCACCTGGG + Intronic
1038253148 8:25925279-25925301 CCTGAGAACTTCAGAAAACCCGG + Intronic
1038917575 8:32041612-32041634 CCTGAGAGCTTTAGAAACCTGGG - Intronic
1039088162 8:33800214-33800236 CCTGATAACTGCAGCCTCGTTGG + Intergenic
1039302565 8:36225068-36225090 CATGAGAACTTCCCCAACCTAGG + Intergenic
1039577369 8:38634162-38634184 CCTGCGATCTTCTGCCAGCTGGG + Intergenic
1039812063 8:41057938-41057960 CCTGGGACCTTGAGCCACCCAGG - Intergenic
1040284093 8:46091283-46091305 CATGAGAAATACAGCCACCCTGG - Intergenic
1040536637 8:48316522-48316544 CCAGTGAACTCCAGCCAACTGGG - Intergenic
1041728164 8:61037773-61037795 TCAGAGAACTTCAGTCACCAGGG + Intergenic
1042392990 8:68257234-68257256 ATTGAGAACTTAAGCCACTTAGG + Intergenic
1042432488 8:68724973-68724995 CCTCAGCACCTCAGCCTCCTGGG + Intronic
1042906514 8:73777541-73777563 CCTGAGGACTCCAGTCACCCTGG + Intronic
1047955485 8:129972150-129972172 GCTGATAATTTCAGCCACTTCGG + Intronic
1049748050 8:144271250-144271272 CCTGACAGCTGCAGCCACTTTGG - Intronic
1056477748 9:86969235-86969257 CCTGAGAAAGTCAGCCAGCAGGG - Intergenic
1057273525 9:93664213-93664235 GCTGAGAACGTGACCCACCTGGG + Intronic
1058430776 9:104917125-104917147 CATGAGAAATTCAGCCAAGTGGG + Intronic
1058998255 9:110321012-110321034 CATGAAAACTTCAGCAACCAGGG + Intronic
1059460937 9:114429601-114429623 CCTGAGAACTTCGGCAGCCCTGG + Intronic
1061243865 9:129391221-129391243 CCTAAGAACAACAGCCACCCCGG - Intergenic
1061578906 9:131524822-131524844 CCTGAGGTTTTCAGCCACTTAGG - Exonic
1203461346 Un_GL000220v1:42509-42531 CATGAGAACTTCCCCAACCTGGG - Intergenic
1187742418 X:22370471-22370493 CAAAAGACCTTCAGCCACCTAGG - Intergenic
1189289790 X:39876990-39877012 GCTGAGAATTCAAGCCACCTTGG + Intergenic
1192002999 X:67176283-67176305 CATGAGAACTTCCCCAACCTAGG - Intergenic
1192481306 X:71488630-71488652 CCAGTGAACTTTAGCTACCTTGG + Intronic
1192625884 X:72728253-72728275 CTTAAGCACTCCAGCCACCTGGG + Intergenic
1194564486 X:95467861-95467883 CCTGTGAGTTTTAGCCACCTTGG + Intergenic
1195111701 X:101656959-101656981 CCCGGGAGCTTCAGCTACCTTGG + Exonic
1195845191 X:109220065-109220087 CCAGATAACTTCAGCAACATAGG - Intergenic
1197875649 X:131102352-131102374 CCTGTGAACTTTAGCTACCTGGG + Intergenic
1199240142 X:145537493-145537515 CATGTGAACTCTAGCCACCTTGG - Intergenic
1199340026 X:146666745-146666767 CATGATAACCTCAGCCAACTAGG + Intergenic