ID: 1126314367

View in Genome Browser
Species Human (GRCh38)
Location 15:47353657-47353679
Sequence GAAGATAAACTGCTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126314362_1126314367 23 Left 1126314362 15:47353611-47353633 CCCTTATCATAATATTTTAAATT 0: 1
1: 1
2: 9
3: 135
4: 1357
Right 1126314367 15:47353657-47353679 GAAGATAAACTGCTGGAGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 257
1126314363_1126314367 22 Left 1126314363 15:47353612-47353634 CCTTATCATAATATTTTAAATTT 0: 1
1: 2
2: 13
3: 158
4: 1468
Right 1126314367 15:47353657-47353679 GAAGATAAACTGCTGGAGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126314367 Original CRISPR GAAGATAAACTGCTGGAGCC TGG Intronic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902398270 1:16144061-16144083 GAAGATGAAAGGCTGGAGGCAGG - Intronic
902557342 1:17254705-17254727 AAAAAAAAAATGCTGGAGCCTGG - Intronic
903144391 1:21361371-21361393 GAAGAAAAACTGCTGGAAAGGGG + Intergenic
903343411 1:22669198-22669220 GCAGATGAATTGCTTGAGCCTGG - Intergenic
904220079 1:28960090-28960112 GAAGACTAACTACTTGAGCCAGG - Intronic
906058462 1:42933407-42933429 GAAGACAAACTCCTGGAGTCAGG - Intronic
907297144 1:53462467-53462489 GAAGAGAAGCTGCTGCCGCCAGG - Intronic
907764961 1:57400159-57400181 CAATATGAACTGCTGGAGACTGG + Intronic
908347863 1:63253674-63253696 GAAGAAAGATTGCTTGAGCCAGG + Intergenic
909012881 1:70354332-70354354 GAAGGGGACCTGCTGGAGCCCGG - Exonic
910212419 1:84807024-84807046 AAAAATAAAATGCTGGGGCCGGG - Intergenic
910848767 1:91630161-91630183 GAGGATAAATTGTTTGAGCCTGG + Intergenic
915496921 1:156288426-156288448 GCAGGAAAACTGCTTGAGCCTGG - Intronic
916336504 1:163677178-163677200 GAGGATACACTTCTAGAGCCAGG + Intergenic
916883591 1:169046081-169046103 GAAGACAAATAGCTGGAGCAGGG + Intergenic
920091350 1:203455319-203455341 GAAGATAATCTACAGGATCCTGG - Intergenic
920259209 1:204677590-204677612 GAAGAGAAGCTGCTGCAGCCTGG + Intronic
920276844 1:204812909-204812931 GAAGATAAAGGGCTGTAGCCTGG - Intergenic
921207892 1:212864870-212864892 GTAGATGAACTGCAGGATCCAGG + Intronic
921901111 1:220451797-220451819 GAAGAGAGTCTGCTAGAGCCAGG - Intergenic
1066980668 10:42411728-42411750 GAAGATAAACTGGTGAATACAGG + Intergenic
1067659293 10:48222356-48222378 GAAGAGATACTGCTGCAGCTGGG - Exonic
1068966743 10:62919471-62919493 GCAGGAAAACTGCTGGAACCTGG - Intronic
1069980689 10:72250396-72250418 GCAGAAGAACTGCTTGAGCCCGG - Intergenic
1070240309 10:74673848-74673870 GAAGATAATCCCCTGGAGTCCGG + Intronic
1071827807 10:89342561-89342583 GAAGATGGAATGCTGGACCCAGG - Intronic
1072193698 10:93096991-93097013 GAAGAGAACCAGCAGGAGCCGGG + Intergenic
1074702612 10:116105817-116105839 GAAGAAAAACTGCTTGCGGCAGG + Intronic
1075337264 10:121617445-121617467 GAAGAAAAACTGGTGGTGCAGGG + Intergenic
1077057709 11:603282-603304 GATGACAAACTGCTTAAGCCCGG - Intronic
1077461443 11:2712760-2712782 GCAGAAAAAGTGCAGGAGCCAGG - Intronic
1079129969 11:17741568-17741590 GAGGATAAACTGGAGCAGCCAGG - Intronic
1080430271 11:32191613-32191635 AACTATAAAGTGCTGGAGCCAGG - Intergenic
1081720859 11:45287036-45287058 GAAGATAAAATGCAGCAGCTAGG + Intergenic
1081725559 11:45325502-45325524 GAAGGTAAAGTCCTGGAACCAGG - Intergenic
1081745867 11:45471888-45471910 AAAGATAATGTGCTGGGGCCGGG + Intergenic
1082626103 11:55487822-55487844 GAGGAAAAACTGCAGAAGCCTGG + Intergenic
1083478059 11:62926592-62926614 CACGTGAAACTGCTGGAGCCCGG + Intergenic
1083802823 11:65056809-65056831 GCAGATGAACTGCTTGAACCTGG - Intronic
1084519508 11:69654927-69654949 GAAGACAAACTGGTGGGGCAAGG - Intronic
1085894110 11:80616778-80616800 GAATATAAAATGGTGGAGCTAGG - Intergenic
1085929575 11:81065186-81065208 GAAAATAAAATCCTGGGGCCAGG + Intergenic
1086830502 11:91556665-91556687 GAAGGTAAACTCCTGGAGATTGG - Intergenic
1087148586 11:94837154-94837176 CAAGACAATTTGCTGGAGCCTGG - Intronic
1088895887 11:114077988-114078010 AAAGATAAACTGTTGGGGTCAGG + Intronic
1089784834 11:120900578-120900600 GAGGAAAAAGAGCTGGAGCCGGG + Intronic
1090772175 11:129930970-129930992 GAAGATGAGCGGCTGGTGCCAGG + Intronic
1093176408 12:15918115-15918137 GAAGAACATCTGCTGGGGCCAGG - Intronic
1094168445 12:27466124-27466146 GAAGATCAAATGCTTGGGCCCGG + Intergenic
1095452264 12:42344800-42344822 GCACAAAAACTGCTTGAGCCTGG - Intronic
1095629534 12:44358576-44358598 GAAGATAAACTTACAGAGCCAGG - Intronic
1098354492 12:69599177-69599199 GAAGGAGAACTGCTTGAGCCAGG - Intronic
1098956628 12:76695514-76695536 GAACATAAACTCCACGAGCCAGG - Intergenic
1099133922 12:78869291-78869313 TAAGATAAACTGTGGTAGCCGGG + Intronic
1100571214 12:95844918-95844940 GAAGAAGAACTGCTTGAACCCGG - Intergenic
1101037748 12:100721770-100721792 GAAGGAAGACTGCTTGAGCCAGG - Intronic
1101216702 12:102593056-102593078 GAAGAGAAACAGCTGGACACTGG - Intergenic
1102381005 12:112466870-112466892 GAAAATAAACTGGCTGAGCCAGG - Intronic
1106180811 13:27367935-27367957 GAATATAAATTGCTGGATCCCGG + Intergenic
1107638535 13:42417479-42417501 GAAGAAGGACTGCTTGAGCCAGG - Intergenic
1109818354 13:67618112-67618134 GAAGATTATCTGCTTGGGCCGGG + Intergenic
1111430929 13:88147323-88147345 GAAGATAAAATTCTGTATCCTGG + Intergenic
1111850222 13:93563703-93563725 CAAGAAAAACGTCTGGAGCCTGG + Intronic
1117536455 14:56707558-56707580 GAGGAGAATCTGCTGGAGCAGGG - Intronic
1119167221 14:72504682-72504704 GAACCTAAACTGCTGTAACCAGG - Intronic
1122924597 14:104893747-104893769 GAAGATCACCTGCAAGAGCCCGG - Exonic
1124483951 15:30100021-30100043 GAAGAAACACTGCTTGAACCAGG + Intergenic
1124519629 15:30397203-30397225 GAAGAAACACTGCTTGAACCAGG - Intergenic
1124539024 15:30569018-30569040 GAAGAAACACTGCTTGAACCAGG + Intergenic
1124578923 15:30934607-30934629 GCAGGTGAACTGCTTGAGCCTGG - Intronic
1124759626 15:32438554-32438576 GAAGAAACACTGCTTGAACCAGG - Intergenic
1124941882 15:34225759-34225781 GAAACTAAACTGCTTGAGGCTGG + Intronic
1126314367 15:47353657-47353679 GAAGATAAACTGCTGGAGCCTGG + Intronic
1128947969 15:71843333-71843355 GCAGAAGAACTGCTGGAACCGGG + Intronic
1130762856 15:86838709-86838731 GCAGAAAGACTGCTTGAGCCCGG + Intronic
1131261333 15:90889569-90889591 GAGGGTGAACCGCTGGAGCCTGG + Exonic
1133442254 16:5830626-5830648 GAAGATAAAATGCAGCAGCTAGG + Intergenic
1135201346 16:20440187-20440209 GAAGCAAAACAGCTGGAGCCTGG - Intronic
1135217763 16:20587677-20587699 GAAGCAAAACAGCTGGAGCCTGG + Intergenic
1135877787 16:26219622-26219644 GAAGAGTAAGTGCTGGAACCAGG - Intergenic
1136252488 16:29014993-29015015 AAAAATACACTTCTGGAGCCTGG - Intergenic
1136632022 16:31494420-31494442 GAGGCTGAACTGCTTGAGCCTGG + Intronic
1138822719 16:60281035-60281057 GCAGATAAAGTTGTGGAGCCAGG - Intergenic
1140228410 16:73097145-73097167 GCAGAAGAACTGCTTGAGCCTGG - Intergenic
1140326949 16:74013620-74013642 GTAGATAAAATTCTGGAGTCAGG - Intergenic
1141185019 16:81780492-81780514 CAAGAGAAACTGCTTGAGGCTGG - Intronic
1141387183 16:83632558-83632580 GAGGATAACCTGCTGTAACCTGG - Intronic
1141389104 16:83649638-83649660 GAAGATAGCCTCCTGCAGCCAGG + Intronic
1143835253 17:9686845-9686867 GAGGATAGACTGCTGGAGCTGGG - Exonic
1144554877 17:16273348-16273370 GAAGATCAAGTGAGGGAGCCAGG + Intronic
1145752252 17:27363548-27363570 CAAGCCAAACTGCTGGTGCCTGG + Intergenic
1145856189 17:28160490-28160512 GATGATTAAAGGCTGGAGCCTGG - Intronic
1146083725 17:29807728-29807750 AAAGATAAGCTGCAGGAGACAGG + Intronic
1146374347 17:32284323-32284345 GATGAGAAACTTCTGGGGCCTGG - Intronic
1148017502 17:44532573-44532595 GAAGGAGAACTGCTGGAACCTGG - Intergenic
1149396256 17:56248082-56248104 GAAGTAACATTGCTGGAGCCTGG + Intronic
1150455294 17:65302449-65302471 GAAAATAAATTTCTGGGGCCAGG - Intergenic
1151452425 17:74206484-74206506 GAAGATAAAGTTCTGGAGATGGG - Intronic
1151537246 17:74745876-74745898 GAAGATAAGCTCCTGGAGAGCGG - Exonic
1152120812 17:78417257-78417279 GAAGACACAAAGCTGGAGCCAGG + Intronic
1152228818 17:79104694-79104716 GAAGAGAAAGTGCTGGGGTCAGG + Intronic
1153738736 18:8100230-8100252 GAAGAAGAACTGCTTGAACCGGG - Intronic
1154168566 18:12034596-12034618 GCAGAAAGACTGCAGGAGCCAGG + Intergenic
1156223699 18:35080987-35081009 GAAGAGAAACTGCAGGAAACAGG - Intronic
1156950512 18:42891166-42891188 GAAGAAAAATTGCTGGGGCCAGG - Intronic
1157604004 18:48914398-48914420 GAAGAGAAACTGCCAGGGCCTGG + Intergenic
1158911780 18:62070897-62070919 GCAGAAAAAGTGCTTGAGCCTGG - Intronic
1159921764 18:74232900-74232922 GCAGAAAAACTGCCTGAGCCCGG + Intergenic
1160331706 18:77998910-77998932 GAAGAAAAGCTGATGCAGCCTGG - Intergenic
1160661754 19:304398-304420 GAAGATTTCCTGCTGGAGGCAGG + Intergenic
1160783634 19:889754-889776 GCAGATCAAGTGCTGGAGCATGG - Exonic
1160919265 19:1512224-1512246 GAAGTCCAAATGCTGGAGCCAGG - Intronic
1161002084 19:1915597-1915619 TAAGATAAAGTACTGGAGCAGGG + Intronic
1162918507 19:13886872-13886894 GAGGATCAACTGCTTGAGCCCGG + Intronic
1163230471 19:15998469-15998491 GAAGAGAAGTTGCTGGAGCTGGG - Intergenic
1163962062 19:20706089-20706111 GCAGAAGAACTGCTTGAGCCTGG - Intronic
1164467121 19:28496847-28496869 GCAGAAATATTGCTGGAGCCTGG + Intergenic
1164634297 19:29781264-29781286 GAACAGCACCTGCTGGAGCCCGG - Intergenic
1165184650 19:34007286-34007308 GATGAGACACAGCTGGAGCCTGG + Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166928049 19:46282971-46282993 TAAAATAAAATGCTGCAGCCAGG + Intergenic
1167269119 19:48498184-48498206 GAAGAGAAAGTGCTGGAGAATGG - Exonic
1167896946 19:52589571-52589593 GCAGAAAAACTGCTTGAACCCGG - Intergenic
927796362 2:26052290-26052312 GTAGGTAGACTGCTTGAGCCTGG + Intronic
928391932 2:30916981-30917003 GAAGGAGAATTGCTGGAGCCTGG + Intronic
928627936 2:33159973-33159995 GTAGAAAAATTGCTTGAGCCCGG - Intronic
929797347 2:45070374-45070396 GAACTTAAACTGATGGGGCCAGG + Intergenic
930310900 2:49738157-49738179 GAAGGGAAATTGCTTGAGCCCGG + Intergenic
930853416 2:55986284-55986306 GAAGACAAACATTTGGAGCCTGG + Intergenic
931394530 2:61874515-61874537 GAAGGAAAACTGCTTGAACCTGG + Intronic
931738446 2:65219818-65219840 GCAGGAAAACTGCTTGAGCCTGG + Intergenic
932386000 2:71332895-71332917 GAACATAAATCGCTGGATCCTGG - Intronic
932749537 2:74362594-74362616 CAGCATAAACTGGTGGAGCCAGG - Intronic
934898770 2:98140708-98140730 GAAGACAAGCTGCTGGGGGCTGG - Intronic
935104706 2:100029834-100029856 GCAGGTAGACTGCTTGAGCCTGG + Intronic
942718617 2:178923397-178923419 AAAAATAAACTGGTGGGGCCGGG - Intronic
943292062 2:186086070-186086092 TTATATAAATTGCTGGAGCCGGG - Intergenic
944621233 2:201517693-201517715 GATGAAATACTGCTGGGGCCAGG + Intronic
945002401 2:205365400-205365422 AAAGAAAATCTGCTGTAGCCTGG + Intronic
947821108 2:233070739-233070761 TTAAATAAACTGCTGGATCCTGG - Intronic
947881565 2:233518471-233518493 GCAGAAAAATTGCTTGAGCCTGG + Intronic
948472733 2:238195354-238195376 GAAGAAAATCTGTTGGAACCTGG + Intronic
1169449364 20:5698239-5698261 GAGGGAAAACTGCTTGAGCCAGG - Intergenic
1171991221 20:31697979-31698001 GCAGGAAAACTGCTTGAGCCCGG - Intronic
1173096712 20:40038501-40038523 GCAGAAAAAGTGCTGGAGCTGGG - Intergenic
1173282774 20:41644034-41644056 GAAGGTGAGCTGCTGGAGCAAGG + Intergenic
1173703967 20:45096617-45096639 GAACATGAGGTGCTGGAGCCAGG + Intronic
1174398992 20:50265684-50265706 GAAGAAAACCTTCTGGAGCGGGG + Intergenic
1175297524 20:57919292-57919314 GAAGAAACACCGCTGGAGACAGG + Intergenic
1177150159 21:17447111-17447133 TAATACAAACTGCTGGAGCTGGG - Intronic
1178991391 21:37359404-37359426 GTAGAAGAACTGCTGGAACCTGG + Intergenic
1180020524 21:45122594-45122616 GAAGATGAGCTGCTGGCCCCTGG + Intronic
1180057427 21:45366144-45366166 GAAGAAAAACTGAAGGGGCCAGG + Intergenic
1181051396 22:20239862-20239884 GCAGCTAAACTGCTGGATCTGGG - Intergenic
1181086044 22:20439830-20439852 GCAGGCAAACTGCTGGAGCCCGG + Intronic
1182026225 22:27121353-27121375 GAAGGAAAAATGCTGGAGTCAGG - Intergenic
1182597872 22:31436111-31436133 GAAGGTAAGCTCCTGAAGCCTGG + Intronic
1182636877 22:31735099-31735121 GAATATACACTGGTGGAGCTGGG + Intronic
1183883927 22:40860744-40860766 GTAGAAAGACTGCTTGAGCCTGG - Exonic
1183945366 22:41322858-41322880 GTAGGAAAACTGCTTGAGCCCGG - Intronic
1184244337 22:43228332-43228354 GAGCATGCACTGCTGGAGCCGGG - Intronic
1184517798 22:44973469-44973491 GAGGACAGGCTGCTGGAGCCAGG + Intronic
1185118838 22:48953518-48953540 GAGTACAAACTGCTGAAGCCTGG - Intergenic
951335806 3:21420405-21420427 GAAGATATATTGCTGGAAACAGG - Exonic
951412298 3:22379802-22379824 AAATACAAACTGCTGGACCCTGG + Intergenic
952325122 3:32313898-32313920 GAAAATTTACTGCTTGAGCCTGG + Intronic
953036797 3:39219007-39219029 GAGGAAACACTGCTGGAACCAGG - Intergenic
954353388 3:50064603-50064625 GTAGAAGAACTGCTGGAACCTGG - Intronic
956153626 3:66269937-66269959 GAAGATATTATGCTAGAGCCTGG - Intronic
957035067 3:75286568-75286590 GAAGAAGAACTGCTTGAACCTGG + Intergenic
957414145 3:79878727-79878749 GAAGATAATCTCCTGAAGTCTGG + Intergenic
957559259 3:81800997-81801019 GGTGATAAACTTCAGGAGCCAGG + Intergenic
958798199 3:98729058-98729080 GAAGAAGAATTGCTTGAGCCTGG - Intergenic
959426721 3:106198716-106198738 GCAGGTGAACTGCTTGAGCCTGG + Intergenic
961304525 3:125948285-125948307 GAAGAAGAACTGCTTGAACCTGG - Intergenic
963759576 3:149273655-149273677 GAAGATGAATATCTGGAGCCAGG - Intergenic
963838219 3:150078763-150078785 AAATACAAACTGCTGGAGCAGGG + Intergenic
967385680 3:188908660-188908682 GAAGATACACTGATGGGGACAGG - Intergenic
968572923 4:1351882-1351904 GAGGATGAACTGCTGGACCACGG - Intronic
973204709 4:47547329-47547351 GAAAATGACCTTCTGGAGCCAGG - Intronic
973249471 4:48046524-48046546 GAAGATGAAGTCCTGGAGACAGG - Intergenic
975839187 4:78455880-78455902 GAAGCTAAGCTGCTGGACCAAGG + Intronic
976269996 4:83221127-83221149 GCAGAAAAACTGCTTGAACCTGG - Intergenic
978329130 4:107592832-107592854 AAAGATAAACTGTTGGAGAAAGG + Intronic
978700005 4:111631228-111631250 GAAGATAAATTGCTGAAGTAGGG - Intergenic
979107567 4:116706691-116706713 GCAGGAAAACTGCTTGAGCCCGG - Intergenic
979271000 4:118761427-118761449 AAAGATACAATGCTGGACCCAGG + Intronic
986348632 5:6856954-6856976 CAAGACAGAGTGCTGGAGCCCGG - Intergenic
986932600 5:12845669-12845691 GAAGATAAAGTGGCGGAGGCAGG - Intergenic
987013322 5:13790787-13790809 GTATAAAAACTGCTGGAGACTGG - Intronic
988512016 5:31872481-31872503 AAAGATAAACTTCTTCAGCCAGG - Intronic
991181808 5:63760727-63760749 GAAAATAAATTGATGGGGCCAGG - Intergenic
995524574 5:113040231-113040253 GAAGATACACTGAGAGAGCCAGG + Intronic
995647873 5:114333196-114333218 GAAGATAAAACACGGGAGCCGGG + Intergenic
996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG + Intergenic
996949036 5:129102791-129102813 GAAAGGAAACTGCTGGAGGCAGG - Intronic
997785582 5:136709746-136709768 AAAGATAACTTGCTGGAGTCTGG - Intergenic
999174421 5:149621850-149621872 GAAGAGAAGCTGCTGGAGGTGGG + Exonic
999892190 5:155990836-155990858 GAAGGTAAATTGGTGGAGCTGGG + Intronic
1000662116 5:163950000-163950022 GGAGAAAGACTGCTTGAGCCAGG - Intergenic
1001337651 5:170813330-170813352 GAAAACAAACTGCTTGACCCAGG + Exonic
1001726130 5:173902267-173902289 AAAGAGAAACTTCTGTAGCCTGG + Intronic
1002397221 5:178967408-178967430 CAGGATAAACTGCTGCATCCTGG + Intergenic
1003176538 6:3756452-3756474 TAAGATTAACTTCTAGAGCCAGG + Intergenic
1004685862 6:17942883-17942905 GAAGGAGAACTGCTTGAGCCTGG + Intronic
1004952181 6:20685882-20685904 GAAAATAAACTACAAGAGCCAGG - Intronic
1005223315 6:23613344-23613366 GAAGATATACAGAGGGAGCCAGG + Intergenic
1006562451 6:34925463-34925485 GAGCATAAACTGTTGGACCCGGG + Intronic
1007106387 6:39285991-39286013 GAAGATAAACTTCAGGAGGATGG - Intergenic
1007726221 6:43917418-43917440 GACTATAAACTGCTGGGGACCGG - Intergenic
1008195092 6:48508980-48509002 TGAGATATACTGCTGGAGTCAGG - Intergenic
1009917820 6:70017952-70017974 TCAGATAAACTTCTTGAGCCAGG - Intronic
1010460862 6:76112641-76112663 GAAGATAACATTCTGCAGCCAGG + Intergenic
1011429914 6:87274550-87274572 AAGAATAAACTTCTGGAGCCAGG + Intergenic
1013277998 6:108605210-108605232 GCAGAAAAACTGCTTGAACCTGG - Intronic
1013282275 6:108649616-108649638 GCAGACAAACGGCTTGAGCCTGG - Intronic
1015228587 6:130886927-130886949 TAAAAAAAACTGCTGGAGGCTGG - Intronic
1015610694 6:135014939-135014961 GAAGATGGATTGCTTGAGCCCGG + Intronic
1015704777 6:136076173-136076195 CAAAATAAACTGATGCAGCCGGG + Intronic
1019559505 7:1648961-1648983 GAAGCTCAAATGCTGAAGCCTGG - Intergenic
1020062690 7:5164465-5164487 GAAGATATACAGGTGGAGACCGG + Intergenic
1020610405 7:10389675-10389697 GAGGCAAAATTGCTGGAGCCTGG - Intergenic
1021995967 7:26178670-26178692 AAAGATGAACTCCCGGAGCCAGG + Intronic
1022255379 7:28651444-28651466 TAAGAAAGACTTCTGGAGCCAGG + Intronic
1022485717 7:30776124-30776146 GAAAATAAACTGTAGGAGGCAGG - Intronic
1022722738 7:32956020-32956042 GCAGAAAAATTGCTGGAACCTGG - Intergenic
1023991841 7:45133223-45133245 GAAGATGATAGGCTGGAGCCAGG - Intergenic
1025978919 7:66391973-66391995 GAAGGAGAACTGCTTGAGCCTGG + Intronic
1026730001 7:72903341-72903363 GAAGAGGAACTGCTTGAACCAGG + Intronic
1028424327 7:90669507-90669529 GAAAGAAAACTGCTGTAGCCTGG + Intronic
1032578089 7:133076850-133076872 TAAGATAAACTAATGGAGGCAGG - Intronic
1035660309 8:1342919-1342941 AAAGAGAAACAGCTGGTGCCTGG - Intergenic
1038674922 8:29614957-29614979 GAAGAGAAACTCCTGGAGGGGGG + Intergenic
1042020880 8:64370610-64370632 GATAATAAACTTCTGTAGCCAGG - Intergenic
1043141750 8:76599065-76599087 GAAAATCCACTTCTGGAGCCAGG + Intergenic
1043427699 8:80164787-80164809 GAACAAGAACTGCTCGAGCCTGG + Intronic
1045272876 8:100676832-100676854 GAAGATAAAATGATGCAGGCAGG - Intergenic
1045866039 8:106866691-106866713 GAAGATTAATTGCTGGAGGAAGG + Intergenic
1046919549 8:119713743-119713765 GCAGAAAAATTGCTTGAGCCTGG + Intergenic
1047692372 8:127369148-127369170 GAAGAAGAACTGCTGGATGCTGG - Intergenic
1048439510 8:134449819-134449841 GCAGACACACTGCTGGAGCAAGG + Intergenic
1049322300 8:142003016-142003038 GAAGAAACCCTGCTGGAGGCTGG + Intergenic
1051731035 9:20142927-20142949 GGAGGTCATCTGCTGGAGCCAGG + Intergenic
1052799943 9:32957634-32957656 GAAGAAAAACAGCTGGAGGAGGG + Intergenic
1052849952 9:33372021-33372043 GAAGGTAAACAGCAGGAGACAGG + Intergenic
1053207685 9:36201022-36201044 GAAGAAAAACTGCTAGAGCTTGG - Intronic
1056991813 9:91420512-91420534 GAAGATAACAAGCTGGGGCCTGG + Intronic
1057769469 9:97954788-97954810 TAAGGGAAAGTGCTGGAGCCAGG - Intergenic
1057964880 9:99492938-99492960 AAAGATAAATTACTGAAGCCAGG + Intergenic
1058850873 9:109011659-109011681 AAAGAGAACCTTCTGGAGCCAGG + Intronic
1059613642 9:115925493-115925515 GATGAGAAATTGCTGGATCCAGG - Intergenic
1059834229 9:118132075-118132097 GAGCAGAAACTTCTGGAGCCTGG - Intergenic
1060015121 9:120080327-120080349 GAAGATAGACAGCTGGAGAGTGG + Intergenic
1060934615 9:127507949-127507971 GAAGATCAGCTCCTGGAACCGGG + Exonic
1061094802 9:128449999-128450021 AAACATAAACTGTAGGAGCCAGG - Intergenic
1061314836 9:129788441-129788463 AAAAAGAAAGTGCTGGAGCCAGG - Intergenic
1186108399 X:6229489-6229511 AAAGATAACCTCCTGGACCCTGG - Intergenic
1186180024 X:6964442-6964464 GAAGACAGTCTGCTTGAGCCTGG + Intergenic
1188928437 X:36075319-36075341 GCAGAAGAACTGCTTGAGCCCGG - Intronic
1189101003 X:38189672-38189694 AAAGATAAACTGGGGGAGCTAGG - Intronic
1194166965 X:90529043-90529065 CAAGATAAACTGGGGGATCCTGG - Intergenic
1196763814 X:119224632-119224654 GAAGATAAACTGTGAGAGCCAGG + Intergenic
1197446885 X:126561658-126561680 GCAGAAAAATTGCTTGAGCCCGG + Intergenic
1197994489 X:132358165-132358187 GATGAAAAACTGCTGGAGATTGG + Intergenic
1198860249 X:141061339-141061361 GAAAGTAAACTTCTGGGGCCAGG - Intergenic
1198902442 X:141526051-141526073 GAAAGTAAACTTCTGGGGCCAGG + Intergenic
1200513232 Y:4106819-4106841 CAAGATAAACTGGGGGATCCTGG - Intergenic
1200811705 Y:7492431-7492453 GCAGAAGAACTGCTTGAGCCTGG + Intergenic
1201485932 Y:14494765-14494787 GCAGATAGATTGCTTGAGCCCGG + Intergenic