ID: 1126319637

View in Genome Browser
Species Human (GRCh38)
Location 15:47408108-47408130
Sequence CCACACCAGGTCACAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126319637_1126319643 -10 Left 1126319637 15:47408108-47408130 CCCATCCTTGTGACCTGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1126319643 15:47408121-47408143 CCTGGTGTGGAAGTGGAGAGAGG 0: 1
1: 0
2: 6
3: 59
4: 593
1126319637_1126319644 -7 Left 1126319637 15:47408108-47408130 CCCATCCTTGTGACCTGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1126319644 15:47408124-47408146 GGTGTGGAAGTGGAGAGAGGTGG 0: 1
1: 0
2: 10
3: 138
4: 1052
1126319637_1126319646 -3 Left 1126319637 15:47408108-47408130 CCCATCCTTGTGACCTGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1126319646 15:47408128-47408150 TGGAAGTGGAGAGAGGTGGTGGG 0: 1
1: 0
2: 9
3: 122
4: 915
1126319637_1126319648 24 Left 1126319637 15:47408108-47408130 CCCATCCTTGTGACCTGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1126319648 15:47408155-47408177 ACAACTACCTTGGCATGTTCTGG 0: 1
1: 0
2: 1
3: 6
4: 80
1126319637_1126319647 14 Left 1126319637 15:47408108-47408130 CCCATCCTTGTGACCTGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1126319647 15:47408145-47408167 GGTGGGTAAGACAACTACCTTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1126319637_1126319645 -4 Left 1126319637 15:47408108-47408130 CCCATCCTTGTGACCTGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1126319645 15:47408127-47408149 GTGGAAGTGGAGAGAGGTGGTGG 0: 1
1: 1
2: 11
3: 128
4: 1242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126319637 Original CRISPR CCACACCAGGTCACAAGGAT GGG (reversed) Intronic
900348257 1:2222028-2222050 GCACACCGGGTCACATGGAGAGG - Intergenic
901631044 1:10648281-10648303 CCCCACCAGGACAGAAGGACTGG + Intronic
902239913 1:15081610-15081632 CCACACTAGGTGACCAGGAAAGG + Intronic
903541222 1:24097419-24097441 CCACTCCAGGGCACATGGCTTGG - Intronic
903759814 1:25689999-25690021 CCACACCAGGAGACCAGGCTTGG - Intronic
904045863 1:27607838-27607860 CCATACCAGGTCACACTCATAGG - Intergenic
904927759 1:34062013-34062035 CCAGATCAGGTCATCAGGATGGG + Intronic
909077283 1:71065493-71065515 CTACACCGTGTCACAGGGATTGG - Intronic
912578849 1:110702099-110702121 ACACATCAGGTCAGAGGGATTGG - Intergenic
912667568 1:111596368-111596390 CCATACTATGTCCCAAGGATTGG - Intronic
915185235 1:154099317-154099339 CCCCACCAGCTCAGAAGGAGTGG + Intronic
920263966 1:204708159-204708181 CCCCACCTGCTCACAGGGATGGG + Intergenic
920506636 1:206519678-206519700 CCACACTAAGTCATAGGGATGGG + Intronic
924508500 1:244709257-244709279 CCACACCTGCTCACAGGGAGGGG + Intergenic
1067844402 10:49708535-49708557 CCAACCCAGGTCACAAAGATTGG - Exonic
1068627995 10:59270084-59270106 CCTCACCAGTCCACAAAGATGGG - Exonic
1069703063 10:70440460-70440482 CGGCACCAGGTCACAAGGGGCGG + Intronic
1069779499 10:70945848-70945870 CCACAATGGGTCACAGGGATGGG + Intergenic
1076501947 10:130944104-130944126 ACACCACAGTTCACAAGGATTGG - Intergenic
1076829990 10:132989221-132989243 CCACACCAGGGCACAGAGAGGGG - Intergenic
1077047507 11:552913-552935 GCACACAAGGTCACAGGGATTGG - Intronic
1077700292 11:4435122-4435144 CCTCTCCAGGTTACACGGATAGG - Intergenic
1079409223 11:20171445-20171467 CCACACTCACTCACAAGGATGGG + Intergenic
1080260979 11:30349559-30349581 CCCCACCAGGTGACAATGATAGG + Intergenic
1087014889 11:93544999-93545021 CCACACTAGGGCAGAGGGATTGG + Intergenic
1087789573 11:102392126-102392148 CCAGACCAGGACCCAAGGAAAGG - Intergenic
1091920812 12:4303211-4303233 TCACACAAGGCCCCAAGGATGGG - Exonic
1092171137 12:6374775-6374797 CCATACCAGGTCTCATGGAGGGG - Exonic
1093518863 12:20024255-20024277 TCTCACCAGATCACAAGGAAAGG - Intergenic
1093919874 12:24847983-24848005 CCTCTCCAGGTCAGAAGCATAGG + Intronic
1094304408 12:29001421-29001443 ACACACCAGGACACAGGGAGGGG + Intergenic
1096499763 12:52057545-52057567 CCACACCAGGTCCAAGGGAATGG + Intronic
1096626392 12:52898623-52898645 CCACCCCAGGTCCCAGGGATAGG + Intronic
1098581398 12:72103400-72103422 CCTAACCAGGTCACAGGGAAAGG + Intronic
1101022342 12:100566025-100566047 CCACCCCAGGTCTCAAGTAGGGG + Intergenic
1102290337 12:111694057-111694079 CCACAGAAGGTCAAAAGGAGAGG - Intronic
1103588217 12:121971745-121971767 CCAAACCATATCACAAAGATTGG - Intronic
1106103999 13:26718157-26718179 CCAAACAAGGTCACAGGGACTGG - Intergenic
1108691338 13:52861933-52861955 CCACACCAGGGCACGTGGCTTGG + Intergenic
1110542815 13:76724967-76724989 CCACAGCAGATAACATGGATGGG - Intergenic
1113896270 13:113766327-113766349 CCACGCCAGCTCACAGGGCTGGG + Intronic
1114532508 14:23404617-23404639 CCCCACCACGTCACAGGGAGGGG + Intronic
1121203238 14:92138718-92138740 CCACGCCCGGCCACAAGTATAGG + Intronic
1124093157 15:26624873-26624895 CCACTGCACGTCACAAGGAGCGG - Intronic
1125733832 15:41909970-41909992 ACAAACCAGGTCCCAAGGACAGG + Intronic
1126319637 15:47408108-47408130 CCACACCAGGTCACAAGGATGGG - Intronic
1127377063 15:58394629-58394651 CCACAGCAGGTCAGAATGACAGG + Intronic
1127515353 15:59688812-59688834 CCACACCAGGGTAAAAGGGTGGG + Intronic
1127617425 15:60700973-60700995 CCAAACCAGGGCACATGGCTTGG - Intronic
1130036748 15:80367977-80367999 CCACCCTAGGTCACACGGAAAGG + Intronic
1132770943 16:1562978-1563000 TCACACCAGGTAGCAAGGAAAGG - Intronic
1132771657 16:1566984-1567006 CCACACCTGGTCAGAAGGGAGGG - Intronic
1132904105 16:2273457-2273479 CCACACCAGGCCACAGGAACAGG - Intergenic
1133603118 16:7359562-7359584 CCAAATCCGGACACAAGGATGGG - Intronic
1134107857 16:11496729-11496751 CCACACCTGGACACATGCATAGG - Intronic
1134181952 16:12055041-12055063 ACACAGCAGGTCACAAGACTTGG - Intronic
1137899637 16:52252943-52252965 CCACTCCAGCTCACAAGAAGGGG - Intergenic
1140277429 16:73523082-73523104 CCAAACCATATCACAAGGAAAGG + Intergenic
1142608463 17:1095296-1095318 CCACAGCCAGTCACAAGGACGGG + Intronic
1145822608 17:27851156-27851178 GCACCCCAGATCACAAGGTTAGG - Intronic
1149467519 17:56891590-56891612 CCCCAAGAGGTCCCAAGGATTGG - Exonic
1149695817 17:58615336-58615358 CCACACTAGGCTACAAGGACAGG + Exonic
1152022021 17:77784921-77784943 CCACACCCGGCCACAAGCAAGGG + Intergenic
1156811922 18:41263166-41263188 CCACACCAGGTGTTAAGAATGGG - Intergenic
1157129667 18:44994957-44994979 CCACACCTGGGCAAAAGGCTTGG - Intronic
1159480749 18:68988346-68988368 GCACACCCGGACACAAAGATTGG + Intronic
1159525427 18:69583030-69583052 TCACACTGGGTCACAAGGAGAGG - Intronic
1159872601 18:73775374-73775396 CCACACCAGGACCCAGGGAGGGG - Intergenic
1159925009 18:74261488-74261510 CCACAGCTGGAAACAAGGATGGG + Intronic
1160583678 18:79901300-79901322 CCACCCTGGGTCACCAGGATGGG + Intergenic
1161566271 19:5004561-5004583 GCACACCGGGTCACAGGGACTGG - Intronic
1163790363 19:19302686-19302708 GCACCCCAGGTCACATGGTTAGG + Intronic
1164550852 19:29211403-29211425 CACCTCCAGGTCCCAAGGATGGG + Intronic
1165160938 19:33815842-33815864 CCACACCAGGTCCCAAGTGTGGG - Intergenic
1166199171 19:41225442-41225464 ACACACCAGGACACAATGAAGGG - Intronic
1167823095 19:51947971-51947993 CAACACCTGGTCCCAAGGACAGG - Intronic
925725011 2:6864186-6864208 CCACCCCAGTTCACAGAGATTGG - Intronic
930240451 2:48930699-48930721 CCACACCAGGTCAGTAGTCTTGG - Intergenic
943178446 2:184509507-184509529 GCACACAAGGACACAAAGATGGG - Intergenic
945756608 2:213855375-213855397 CCACCCGAGGTCACAAAGCTAGG - Intronic
946644927 2:221823199-221823221 CCACCAGAGGACACAAGGATTGG - Intergenic
946888772 2:224252099-224252121 CCACACCAGGCCAAAAGTCTAGG - Intergenic
948190379 2:236053629-236053651 TGACACCAGGACACAAAGATGGG - Intronic
948290247 2:236819130-236819152 CCATACAGGGCCACAAGGATTGG + Intergenic
1169534624 20:6525147-6525169 CCACCCCAGGGCCCAAGGAGAGG - Intergenic
1170663379 20:18363986-18364008 CCACTCCATGGCCCAAGGATCGG + Intergenic
1170818518 20:19735848-19735870 CAACACGAGGTCCCAAGGAAAGG - Intergenic
1171465291 20:25323786-25323808 CCCCAACAGGTCTGAAGGATGGG + Intronic
1174796956 20:53530236-53530258 ACACACCAGAGCACATGGATTGG + Intergenic
1175127997 20:56766794-56766816 CCACCACAGGTCACAGTGATTGG - Intergenic
1175727185 20:61326725-61326747 CCACACCAGGTCACATCAATTGG + Intronic
1176204621 20:63881572-63881594 CGGCACCAGGTCCCAATGATGGG - Intronic
1178372095 21:32034829-32034851 CCACACCATGTCCCAAGCTTAGG + Intronic
1183294739 22:37022864-37022886 CCCCACCAGGGCACATGGCTGGG - Intronic
1184352490 22:43953455-43953477 CCAAAGCAAGTCACATGGATGGG + Intronic
1184777011 22:46628302-46628324 CCACACCAGGGGACAAGGACAGG - Intronic
950474528 3:13207158-13207180 AGACATCAGGTGACAAGGATAGG - Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
962696044 3:137948365-137948387 CCACACCAGGTCAGATGAAGAGG + Intergenic
962998783 3:140656606-140656628 TCTCACCAAGTCACAAGGAATGG - Intergenic
967931604 3:194694234-194694256 CCACACCAGATACCAAGGGTGGG - Intergenic
968563721 4:1298302-1298324 CCTCTTCAGGTCACAGGGATGGG - Intronic
970290445 4:14565536-14565558 CCAAACCATATCAGAAGGATAGG - Intergenic
974896399 4:67944873-67944895 CCACACCAGCTCTCTAAGATTGG + Intronic
975712292 4:77172949-77172971 CCAAACCAGGACTCAAGGACTGG - Intronic
976018827 4:80594457-80594479 CCAAACCATATCACTAGGATTGG + Intronic
976350380 4:84053828-84053850 ACACACCAGGACACATGGCTTGG + Intergenic
977976025 4:103268165-103268187 TCACACCAGGTCACCAGCAATGG - Intergenic
978486039 4:109254368-109254390 TTACCCCAGGTCACAAGGCTGGG + Intronic
980054811 4:128069152-128069174 CCAAACCAGTCCACAAGCATAGG - Intronic
983977102 4:173948700-173948722 TCAAACCAGGTCCCAAGGATGGG + Intergenic
988592677 5:32562641-32562663 CCACACCAGGGCAAGAAGATAGG - Intronic
991679418 5:69124195-69124217 CAATCCCAGGTCACAAGAATGGG - Intronic
992442028 5:76805154-76805176 CCACACCTGGCCACAATAATAGG + Intergenic
993702108 5:91130813-91130835 CTACACATGGACACAAGGATGGG - Intronic
994034123 5:95178788-95178810 CCACACCAGCTCACCAGTAATGG + Intronic
996013217 5:118503762-118503784 CCAAACTACGTCACAAGGGTAGG - Intergenic
1001202590 5:169731828-169731850 CCACACCAGGCCCCAAATATAGG - Intronic
1002476327 5:179468640-179468662 CCACACAAGGTCACGAGCCTGGG + Intergenic
1006740110 6:36302005-36302027 CCACACAACCTCACAAGGAGTGG + Exonic
1007227624 6:40326013-40326035 CCAGAACGGGTCACATGGATGGG - Intergenic
1009526369 6:64751409-64751431 CCACACCCGGGCACAAGTCTGGG + Intronic
1018810556 6:167295116-167295138 CCAGGGCAGGTCACAGGGATGGG + Intronic
1019735045 7:2646458-2646480 CCCCACCAGGCCCCAAGGAGAGG - Intronic
1019982188 7:4629759-4629781 CCCCACCAGGTCACATGGGTAGG + Intergenic
1022383201 7:29879938-29879960 CCAAAACAAGTCACAAGGATGGG + Intronic
1023238721 7:38118970-38118992 ACATTCCATGTCACAAGGATAGG + Intergenic
1026824517 7:73573133-73573155 CCACACCAGGTCCCTAGGGAAGG - Intronic
1026877305 7:73887002-73887024 CCACACCAGGGCACAGGGCTAGG - Intergenic
1032178789 7:129657196-129657218 CCACACCAAGTCACAGGAAATGG - Intronic
1035327218 7:158072984-158073006 CTGCACCAGGTCACAAGCCTGGG - Intronic
1037493114 8:19414020-19414042 TTGCACCAGCTCACAAGGATTGG + Intronic
1037709532 8:21344736-21344758 CCCCACCACTTCACAAGGCTGGG + Intergenic
1039491198 8:37948680-37948702 CCACACCAGGCCAAAAGGTATGG + Intergenic
1040442757 8:47461943-47461965 TCACACCAGCTCACCAGGAAGGG - Intronic
1044537919 8:93378754-93378776 CCTCAGCAGGGCACAAGCATGGG - Intergenic
1045349422 8:101324515-101324537 AAACACCAGATGACAAGGATTGG + Intergenic
1047837038 8:128705194-128705216 CCCCAAAAGGTCACAATGATAGG + Intergenic
1049181068 8:141222509-141222531 CCACCCCAGGTCACACAGCTAGG + Intronic
1049536262 8:143183844-143183866 CCACCCCAGGTATCTAGGATGGG - Intergenic
1061859197 9:133459589-133459611 TCACACCAGGACACACGGGTGGG - Intergenic
1062189628 9:135241292-135241314 CCCAACCAGGTCAGAAGGAAAGG + Intergenic
1185479254 X:433871-433893 CCACACCAGGTCACAGAAAGTGG - Intergenic
1185942011 X:4332404-4332426 CCACAAGAAGTCACAAGGGTGGG - Intergenic
1189602091 X:42637860-42637882 CCACACAAGGTAAAAAGGATGGG + Intergenic
1190302286 X:49063980-49064002 CCTCAGCAGGGCACAAGGAGTGG - Exonic
1192895529 X:75439694-75439716 CCACATTAGGTCACAAGCAATGG - Intronic
1195444598 X:104937541-104937563 CCACACCTGGATCCAAGGATTGG + Intronic
1198924219 X:141769706-141769728 CCACACAAGGTGACAAGTTTAGG + Intergenic
1199812349 X:151362605-151362627 CCAGTCCAGGTCACCAGGCTTGG + Intergenic
1200136500 X:153877659-153877681 CCACACCAGTTCTCAAGGGAAGG - Intronic
1200332777 X:155314687-155314709 TCACACCAGCTCACAAGCAATGG + Intronic
1201410069 Y:13690778-13690800 CAGCACCAGGTCAAAAAGATTGG + Intergenic
1201727135 Y:17166334-17166356 CCACAAGAAGTCACAAGGGTAGG - Intergenic