ID: 1126325851

View in Genome Browser
Species Human (GRCh38)
Location 15:47476577-47476599
Sequence AAGGAGATAGAGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 930
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 856}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126325851_1126325858 21 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325858 15:47476621-47476643 TAGAGACAAACACTGGGAATGGG 0: 1
1: 0
2: 3
3: 25
4: 232
1126325851_1126325861 26 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325861 15:47476626-47476648 ACAAACACTGGGAATGGGGGTGG 0: 1
1: 0
2: 2
3: 33
4: 340
1126325851_1126325864 29 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325864 15:47476629-47476651 AACACTGGGAATGGGGGTGGGGG 0: 1
1: 0
2: 12
3: 95
4: 714
1126325851_1126325855 14 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325855 15:47476614-47476636 AATTGTTTAGAGACAAACACTGG 0: 1
1: 0
2: 1
3: 18
4: 248
1126325851_1126325856 15 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325856 15:47476615-47476637 ATTGTTTAGAGACAAACACTGGG 0: 1
1: 0
2: 1
3: 20
4: 205
1126325851_1126325860 23 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325860 15:47476623-47476645 GAGACAAACACTGGGAATGGGGG 0: 1
1: 0
2: 4
3: 32
4: 418
1126325851_1126325859 22 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325859 15:47476622-47476644 AGAGACAAACACTGGGAATGGGG 0: 1
1: 0
2: 1
3: 31
4: 395
1126325851_1126325865 30 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325865 15:47476630-47476652 ACACTGGGAATGGGGGTGGGGGG 0: 1
1: 2
2: 22
3: 112
4: 889
1126325851_1126325863 28 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325863 15:47476628-47476650 AAACACTGGGAATGGGGGTGGGG 0: 1
1: 0
2: 7
3: 62
4: 578
1126325851_1126325857 20 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325857 15:47476620-47476642 TTAGAGACAAACACTGGGAATGG 0: 1
1: 0
2: 1
3: 26
4: 276
1126325851_1126325862 27 Left 1126325851 15:47476577-47476599 CCTTCCTCATGCTCTATCTCCTT 0: 1
1: 0
2: 6
3: 67
4: 856
Right 1126325862 15:47476627-47476649 CAAACACTGGGAATGGGGGTGGG 0: 1
1: 1
2: 3
3: 40
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126325851 Original CRISPR AAGGAGATAGAGCATGAGGA AGG (reversed) Intronic
900356369 1:2266755-2266777 AATGAGATAGAAAATGAAGATGG + Intronic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
900955184 1:5882450-5882472 AAGGAGAAAGAACAAGAGGCGGG - Intronic
901142372 1:7043451-7043473 AAGGAGATGGTGCATGATGTCGG + Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901762115 1:11478474-11478496 AAGGAGAAAGAGCCTGGGGGAGG - Intergenic
902729071 1:18356923-18356945 ATGGAGATTGAGGATGGGGAGGG + Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903405850 1:23095165-23095187 AAGGAAATAGAGAAAGGGGAAGG + Intronic
904203877 1:28839901-28839923 AAGGAGACAGTGCAAGGGGAAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
905108936 1:35580366-35580388 AAGGGGTTGGAGCAAGAGGAAGG - Intronic
905714298 1:40134869-40134891 AAGGAGACAGAGAAGGAGAAGGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905875229 1:41427908-41427930 AAGGAGTGAGAGGAGGAGGACGG - Intergenic
905929752 1:41778809-41778831 AAGGAGATGGAGCATGATGAGGG + Intronic
905960421 1:42038017-42038039 GAGAAGATAGAGGATGGGGAAGG - Intergenic
906720562 1:48001253-48001275 GAGGAGATAGAGCCTGAGGGTGG - Intergenic
906859304 1:49341877-49341899 AAGGAGAGAGAGGAGGAGAAAGG - Intronic
907289999 1:53407505-53407527 AAGGCTAGAGAGGATGAGGATGG + Intergenic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
907984359 1:59516014-59516036 AAGGTGATAGTCCATGATGACGG + Intronic
908261085 1:62339610-62339632 TAGGAGACATAGGATGAGGATGG + Intergenic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909802200 1:79823834-79823856 GAGGAGACAGAAGATGAGGAAGG - Intergenic
910559587 1:88576243-88576265 AAGGAGGTAGAACATGAAGTTGG + Intergenic
910605803 1:89082704-89082726 GAGGTGGTAGAGCATGAAGAGGG + Intergenic
911530499 1:99037795-99037817 AAAGAGAGAGAGCTTGAGCAGGG + Intergenic
912228967 1:107770061-107770083 AAGGGGACTGAGCATGAGGTGGG - Intronic
912498481 1:110106568-110106590 AAGGAGCTGGAGCAGGAGGAAGG - Intergenic
913586105 1:120277420-120277442 AAGGAAATAGAGGGTGGGGAGGG - Intergenic
913622081 1:120620949-120620971 AAGGAAATAGAGGGTGGGGAGGG + Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914568114 1:148889278-148889300 AAGGAAATAGAGGGTGGGGAGGG - Intronic
914604710 1:149240971-149240993 AAGGAAATAGAGGGTGGGGAGGG + Intergenic
915110455 1:153561572-153561594 CAGGAGAAAGTGGATGAGGAGGG - Exonic
915603815 1:156938586-156938608 AAGGAGAGAGGGCAGGAGGTGGG + Intronic
915632952 1:157166164-157166186 ACAGAGGTAGAGGATGAGGATGG - Intergenic
915770972 1:158423184-158423206 AATAAGATAGAGGAGGAGGAGGG - Intergenic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916171318 1:162003457-162003479 AAGGAGATGGAGCAAGACCATGG + Intronic
916403064 1:164469667-164469689 AAGGAGATAGAACATAAGATTGG - Intergenic
917255711 1:173114097-173114119 AAGGAGATTGAAGATGAAGATGG - Intergenic
917387267 1:174491044-174491066 AGGGAGATAGAGCATGAGGCAGG - Intronic
917470077 1:175319032-175319054 AAGGAGGTAGGGCATGGGGTTGG - Exonic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918057047 1:181031174-181031196 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
918171562 1:182002965-182002987 AAGGAGGTAGTGCAGGAAGAAGG + Intergenic
918930573 1:190850934-190850956 AAAAAGATGGAGCATGAAGAAGG - Intergenic
918948915 1:191109259-191109281 AGAGAGATAGAGTATGTGGAGGG + Intergenic
919392429 1:197003892-197003914 AAGGAGATAATTCATGAAGAAGG + Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
920006471 1:202836911-202836933 TAGGAGAAAGAGCAAGAGGTGGG + Intergenic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920062086 1:203233934-203233956 GAGGAGATGGAGCAGGAGGCAGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920503657 1:206501323-206501345 AGGGAGATAGTGGATGAGCAGGG + Intergenic
920603576 1:207355358-207355380 GAGGAAAGAGAGAATGAGGATGG + Intronic
921167819 1:212519558-212519580 AAAAAGGTAGAGCAAGAGGAAGG + Intergenic
921295929 1:213703919-213703941 GAGGAGATAGAGAATGAGACAGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921356850 1:214292896-214292918 AAGGAGGCAGAGGATAAGGAAGG - Intronic
921793078 1:219312165-219312187 AAGGACATATTGCAGGAGGAAGG + Intergenic
922077692 1:222264138-222264160 GTGGAGATAAACCATGAGGAAGG - Intergenic
922479925 1:225932694-225932716 AAGTAGATGGATCATGAGGTCGG + Intergenic
922678880 1:227573187-227573209 AAGGAGATACAGCGTGGGGGTGG + Intronic
922742250 1:228020540-228020562 AGGAAGAGAGAGGATGAGGAAGG + Intronic
922793112 1:228321509-228321531 AAGGAGATGAAGCAGCAGGAAGG + Exonic
922904833 1:229166219-229166241 AAGTAGAAAGAGCATCAGGTGGG + Intergenic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
924447051 1:244142856-244142878 CAGGAGATAGGGAAAGAGGAAGG - Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063997051 10:11629278-11629300 AAAGAGATGGAGGAAGAGGAAGG - Intergenic
1064019686 10:11799167-11799189 CAAGAGAGAGAGCATAAGGAAGG - Intergenic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064707064 10:18084091-18084113 AAGAAGTGAGAGAATGAGGAAGG - Intergenic
1065257020 10:23880413-23880435 ATGGAGATAGAGTAGAAGGATGG + Intronic
1065431108 10:25656861-25656883 ATGGAGATAGAGTAAAAGGATGG - Intergenic
1065672417 10:28134793-28134815 AAAAAGATAGATCATGAGAAAGG + Intronic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066502434 10:36007104-36007126 AGGGAGAGAGAGAATGAGGGTGG - Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067261446 10:44696554-44696576 AAGGAAACAGAGCATGACCAGGG - Intergenic
1067307978 10:45083393-45083415 AAGGAGAGAGGGGATGAGGGAGG - Intergenic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1068051593 10:51956965-51956987 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1068174778 10:53444329-53444351 AAAGAGATGGAGCAAGATGAGGG + Intergenic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068781631 10:60925085-60925107 AGGGAGAGAGAGCATGGGGTAGG - Intronic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1069060968 10:63894139-63894161 AAGGAAAGAGAGGAGGAGGAAGG - Intergenic
1069817976 10:71210556-71210578 AAGGAGAGAGAGAAAGAGGTTGG + Intergenic
1070172210 10:73941317-73941339 AGGGATAAAGACCATGAGGACGG - Intergenic
1070692071 10:78534245-78534267 GAGGAGACAGAGGAGGAGGAGGG - Intergenic
1070964767 10:80523147-80523169 AGTGGGATAAAGCATGAGGAGGG - Exonic
1071265734 10:83963194-83963216 AGGTAGTTAGATCATGAGGATGG + Intergenic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071383999 10:85101426-85101448 GAGGAGGTAGAGCAAGAGGAAGG - Intergenic
1071473576 10:86005406-86005428 AAGGAGAAAGATCATGAGCAAGG + Intronic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1071877757 10:89861295-89861317 AAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1071947315 10:90659772-90659794 GAGGAAATAGAGCAAGAGCAAGG + Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072857119 10:98959879-98959901 AAGGAGAAAGAAGAGGAGGAGGG - Intronic
1073065943 10:100759247-100759269 AAGGAGAAAGGGGAAGAGGAAGG + Intronic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073991095 10:109262764-109262786 AAGGCGAGAGAGCATGTGTAGGG + Intergenic
1074135543 10:110623334-110623356 AAGGACAGAGAGTAGGAGGAGGG - Intergenic
1074813929 10:117130893-117130915 AAGGAGAAAGAGCAGGAAGCTGG + Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074856099 10:117474664-117474686 TAGGAGATGGAGGATGGGGATGG + Intergenic
1074933682 10:118156690-118156712 AAGGAGAGAGGGTAGGAGGAGGG + Intergenic
1075056470 10:119222596-119222618 AGGGAGGCAGAGCAGGAGGAGGG - Intronic
1075482730 10:122796362-122796384 AAGGAGAGAGAGGGAGAGGAAGG + Intergenic
1075709048 10:124521045-124521067 AAGGGGACAGTGCAGGAGGAGGG - Intronic
1076150889 10:128161225-128161247 AAGGAAAGCGAGAATGAGGAAGG - Intergenic
1076370671 10:129951100-129951122 TAGGAGACAGACCAGGAGGACGG - Intronic
1078024228 11:7679546-7679568 CAGGAGAGAGAGAATGAGGGAGG - Intergenic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078688406 11:13554543-13554565 AAGGAGAGAGAGCATGTGCAGGG + Intergenic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1079117751 11:17651442-17651464 GAAGAGATAGAGCATGAGTTAGG + Intergenic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079493536 11:21015672-21015694 AAGGAGAAAGAACTAGAGGAGGG - Intronic
1079686879 11:23370494-23370516 AATGAGATAGAGCAGTAAGAGGG + Intergenic
1080215611 11:29836617-29836639 CAGTAGGTAGAGGATGAGGAGGG + Intergenic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1081095270 11:38924971-38924993 AGGGAGATAGAGAAGGAAGAAGG - Intergenic
1083463877 11:62832680-62832702 AAGGAGGAAGAGTCTGAGGACGG - Intronic
1083477061 11:62921546-62921568 GAGGAGAAAGGACATGAGGAAGG + Exonic
1083630122 11:64091036-64091058 AAGAAGACAGAGGAGGAGGAGGG + Intronic
1084453880 11:69256285-69256307 CAGGAGAGAGAGCGCGAGGAAGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084576094 11:69988900-69988922 AAGGAGGGAGGGAATGAGGAAGG + Intergenic
1085325967 11:75606808-75606830 AAGGGGACAGAGCTAGAGGAGGG - Intronic
1086210255 11:84309696-84309718 AAGAGGATAGACCATGAAGAAGG + Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1087421911 11:97939434-97939456 AAAGAGATAGAGATTCAGGAAGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087736925 11:101844670-101844692 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088381277 11:109195117-109195139 AAAGAGAGAGAGAAAGAGGAAGG - Intergenic
1089232766 11:116994297-116994319 AAGGAGATAGGGAATTAGCAAGG + Intronic
1090028187 11:123185397-123185419 AGAGAGAGAGAGCAGGAGGAAGG + Intronic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090846199 11:130532120-130532142 AAGGAGACAGAGCCGGAGGCAGG - Intergenic
1090968924 11:131622973-131622995 AAAGAGAAAGAGGAAGAGGAAGG + Intronic
1091339829 11:134801673-134801695 AAGGAAACAGGGCAGGAGGAAGG + Intergenic
1091665924 12:2418542-2418564 GAGGAGAGAGAGGAGGAGGAGGG + Intronic
1091690293 12:2591643-2591665 AGAGAGAGAGAGCATGAGGAAGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092298213 12:7219371-7219393 ACGGAGATAGAGTAGAAGGATGG - Intergenic
1092760284 12:11804414-11804436 AAGGTGATGGAGGATGAGGGTGG - Intronic
1092826132 12:12400717-12400739 AAGGATATAAAGGATGGGGAGGG - Intronic
1094293419 12:28877273-28877295 AAGGAGATGGAGGAGAAGGAAGG - Intergenic
1095991482 12:48037525-48037547 TAGGAGAGAGGGCAGGAGGAGGG + Intergenic
1096402604 12:51319620-51319642 AAGGAGAAAGAGCAAGAGCAAGG + Intronic
1097098755 12:56571252-56571274 ATGGAGGAAGAGCAGGAGGAGGG - Intronic
1097723879 12:63052548-63052570 AAGGAGCTAGAGAATGAGTATGG + Intergenic
1098460768 12:70730839-70730861 AATGAGAGAGAGCAGAAGGAAGG + Intronic
1098460771 12:70730865-70730887 AAGGAGATAGAGAAAGAGAGAGG + Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099207221 12:79742599-79742621 AAGGAAAGAGGGCATGAGTAAGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099948453 12:89272510-89272532 CAGGAGAGAGAGGATCAGGAAGG - Intergenic
1099993514 12:89752406-89752428 AAGTAGAGAGAGCATGAGCAAGG - Intergenic
1100257545 12:92899751-92899773 AATGAGAACGAGCAAGAGGAAGG - Intronic
1100588463 12:96001146-96001168 AAGGAGACAGAGGAGGAGAAAGG + Intronic
1101051711 12:100870535-100870557 AAGAAAATAGAGAATCAGGATGG - Intronic
1101321001 12:103673027-103673049 AATGAGATGGTGCATGTGGAAGG + Intronic
1102570238 12:113823063-113823085 GAGGAGACAGGGGATGAGGAAGG - Intronic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103185261 12:118951319-118951341 CAGTAGACAGAGCATGAGGGTGG - Intergenic
1103262203 12:119597112-119597134 AAGGACAAAGAGGAAGAGGAAGG + Intronic
1104081630 12:125434886-125434908 AAGAAGTTTCAGCATGAGGAGGG - Intronic
1104121856 12:125807479-125807501 AAGGAGATAGTTCATGGGAAGGG - Intergenic
1104212360 12:126701449-126701471 AAGGAGTTAGAAAATGATGATGG + Intergenic
1104469570 12:129018665-129018687 AAGGAGATGGTGCAGGAAGAAGG - Intergenic
1105250239 13:18692658-18692680 AAGAGGATAAAGTATGAGGAAGG - Intergenic
1105467544 13:20660149-20660171 AAGGAGCTAGAGAATGTGGGAGG + Intronic
1105787919 13:23768067-23768089 AAGGAGAAAGAGGACAAGGAGGG - Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106216577 13:27707215-27707237 AAAGAGAGAGAGCAAGAGGAGGG + Intergenic
1106359968 13:29021962-29021984 AAGGAGAAAAAGCATGAGAGCGG + Intronic
1107201332 13:37722110-37722132 AAGGAACTAGAGACTGAGGAAGG + Intronic
1107213060 13:37881428-37881450 AAGGAGAGAGAGAGAGAGGACGG + Intergenic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107433698 13:40362921-40362943 AAGGAGCTAGAGCAGGAAGGTGG - Intergenic
1107453107 13:40529810-40529832 AAAGAGATAGAGAAGGAGGGAGG + Intergenic
1108185751 13:47886944-47886966 CAAGAGAGAGAGCATGAGCAGGG + Intergenic
1108257904 13:48628352-48628374 CAGGAGAGAGAGCATGTGCAGGG + Intergenic
1108470832 13:50765431-50765453 AAGGAGAAAGAAGAGGAGGAAGG + Intronic
1108711354 13:53035602-53035624 AAAGAGATGGAGGGTGAGGATGG - Intronic
1109226932 13:59708291-59708313 AAGGAAAGAGAGGATGAGGCTGG - Intronic
1109749961 13:66677606-66677628 AGAGAGAAAGAGCATGGGGAAGG - Intronic
1110175831 13:72554336-72554358 AAGGAGATAGAGTAAAATGATGG + Intergenic
1110212873 13:72993525-72993547 AAGGAAATAAAGAATCAGGATGG + Intronic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1111176998 13:84607886-84607908 GAGGTGAAAGAGTATGAGGAAGG + Intergenic
1111392234 13:87611393-87611415 AGAGAGAGAGAGCATGAAGAGGG - Intergenic
1111974628 13:94952572-94952594 CAGAAGATAGAGCTTGAAGAAGG - Intergenic
1112336593 13:98522000-98522022 AAGGAGAGAGTGGAGGAGGAGGG - Intronic
1112349051 13:98617730-98617752 AAGCGGACAGATCATGAGGACGG + Intergenic
1112786251 13:102954912-102954934 AAGAAGAAAGAGGAAGAGGAGGG - Intergenic
1113092011 13:106626484-106626506 AACCAGCTATAGCATGAGGAAGG + Intergenic
1113159584 13:107364945-107364967 AGGGAGAGAGAAAATGAGGAGGG - Intronic
1113214213 13:108019052-108019074 AGGGAGGTAAAGCAAGAGGAAGG - Intergenic
1113289925 13:108894103-108894125 CAGGAGAGAGAGCATGCGCAGGG + Intronic
1113920387 13:113904895-113904917 AAGGTGATAAAGAAAGAGGAAGG + Intergenic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114657675 14:24325813-24325835 AAGGAGATGGAGAAAGAGGTGGG - Exonic
1114730841 14:24990961-24990983 AAGGAGAGAGAGCATGAGAAAGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115670453 14:35605989-35606011 GAAGAGAAAGAGCATCAGGAAGG + Intronic
1115964933 14:38877402-38877424 AGGGAGAGGGAGCATGAGAAAGG - Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116654387 14:47632785-47632807 AAGGAGAGAGAGGTTGGGGAAGG - Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117412289 14:55461383-55461405 AAGGAGATAGGGCATGCAGAGGG - Intergenic
1118570092 14:67186225-67186247 AAGGAGAGAGATTATGAGAAAGG + Intergenic
1118981901 14:70723938-70723960 AAGATGACAGAGGATGAGGAGGG + Intronic
1119031991 14:71200013-71200035 AGGGAGACAGTGCAGGAGGAAGG + Intergenic
1119205928 14:72793543-72793565 ATGGAGGTAGAGTGTGAGGATGG - Intronic
1119770234 14:77216063-77216085 AGGGAGATAGAGAGAGAGGAAGG + Intronic
1119863413 14:77953691-77953713 ATGGAAACAGGGCATGAGGAAGG - Intergenic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120645139 14:87065021-87065043 CAGGAGAGAGAGCCAGAGGAGGG + Intergenic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1120908602 14:89643888-89643910 AAGGAGGTAGAGGCTGAGGCTGG + Intergenic
1120923170 14:89773204-89773226 AAGGGGAAAGAGCACGTGGAGGG + Intergenic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1121843496 14:97154147-97154169 AAGGAGGGAGAGAGTGAGGAAGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121990621 14:98553373-98553395 AGGAAGAGAGAGGATGAGGAAGG - Intergenic
1122322240 14:100862054-100862076 AAGGAGAAAGAAGAAGAGGAAGG - Intergenic
1122322264 14:100862170-100862192 AGGGAGAAAGAGGAGGAGGAGGG - Intergenic
1122891420 14:104733867-104733889 AAGGAGAGAGGGCAACAGGAAGG + Intronic
1124035649 15:26051602-26051624 AAGGAGGGAAAGCAGGAGGAAGG - Intergenic
1124098203 15:26669116-26669138 AAGGAGACAGAACAAGAAGAGGG - Intronic
1124866018 15:33492021-33492043 AAGAAGATATGGCCTGAGGAGGG + Intronic
1124955086 15:34355099-34355121 GAGGAGCTAGAGCAAGAAGAAGG + Exonic
1125125651 15:36217084-36217106 AAGGAGATAGAGGGTTAGAAGGG - Intergenic
1125320392 15:38481183-38481205 AAGGAGATAATGCATAAGCAAGG - Intronic
1125989132 15:44088566-44088588 AAGAAGAGAAAACATGAGGAGGG - Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1126560959 15:50043501-50043523 AAGGAGGAAGAGGAAGAGGAGGG - Intronic
1126904893 15:53353972-53353994 ATGGAGATAGAGTAGAAGGATGG - Intergenic
1126920550 15:53517807-53517829 AAAGAGAAAGACCAAGAGGAGGG + Intronic
1128618971 15:69132768-69132790 AGGGAGCCAGAGCATGAGGAAGG + Intergenic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1128907558 15:71481616-71481638 AAGAGGCTAGAGCATGAAGAGGG - Intronic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129834952 15:78696578-78696600 ATGGAGATAGAGTAGAAGGATGG - Intronic
1130160377 15:81393049-81393071 AAGGAGACAAAACATGTGGATGG - Intergenic
1130205315 15:81870071-81870093 AAAGAGATAGAGAATGGGGAGGG - Intergenic
1130424965 15:83787820-83787842 AAGGAGAAAGAGGAGGGGGAGGG - Intronic
1130681589 15:86001641-86001663 AAAGAGAAAGAGCAGGGGGAGGG - Intergenic
1130744751 15:86639072-86639094 AAGGCAATAGAGTATGAGCAAGG + Intronic
1130853174 15:87817918-87817940 AAAGAGATAGGCCATGAGGGAGG + Intergenic
1131353123 15:91719466-91719488 TAGGAGAAAGACCATGTGGAGGG - Intergenic
1131456190 15:92584481-92584503 AAGGAGAGAGAGTAAGTGGATGG - Intergenic
1131822487 15:96286846-96286868 AAGGAAGCAGAACATGAGGAAGG + Intergenic
1131901108 15:97088671-97088693 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1131901118 15:97088709-97088731 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1132081847 15:98872761-98872783 TAGGAGGCAGAGCATGGGGATGG - Intronic
1133392848 16:5423076-5423098 AAGGAGAGGGAGGAAGAGGAAGG + Intergenic
1133467874 16:6045265-6045287 AAGGAGATAGAACATTTGGGTGG + Intronic
1134171917 16:11976109-11976131 AAGGAGATTGAGGAGGTGGAGGG - Intronic
1134892584 16:17854062-17854084 AAGGAGATGGAAGATGAGGGAGG + Intergenic
1135161589 16:20101405-20101427 GAGGTGATAGAGAAAGAGGAAGG + Intergenic
1135163241 16:20115971-20115993 AGGGAGATAAAGCATGATAATGG + Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1135827058 16:25738223-25738245 TAGGAGACAGAGGATGAGCAAGG - Intronic
1136247927 16:28985825-28985847 AAGGAGACACAGCTTGGGGATGG - Intronic
1137906871 16:52332319-52332341 AAGGAGCTAGAGCAGGGGGAGGG - Intergenic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138293860 16:55870323-55870345 AAGAAGAAAGAGGAAGAGGAAGG + Intronic
1138420271 16:56894537-56894559 AAGGAGATAGGGAATGAGGAGGG - Exonic
1139018432 16:62718417-62718439 AAGGAGATAGAGCAGAAGCTTGG + Intergenic
1139321657 16:66119218-66119240 AAGGAGGTATAGGAGGAGGAAGG - Intergenic
1139425064 16:66874060-66874082 AAGGAGGTAGAGGAGGAGGGAGG - Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139680871 16:68561189-68561211 AAGAAGATAAAGCATTAGGCTGG - Intronic
1139946339 16:70644944-70644966 AAGGAGGAAGAGGAGGAGGAAGG + Intronic
1140026759 16:71297788-71297810 AAGGAGGTAGAGCGAGAGAAAGG - Intergenic
1140832803 16:78767073-78767095 AAGGAGAGAGAGAAGGAGGGAGG - Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141221924 16:82078835-82078857 ATGGAGATAGAGTAGAAGGATGG + Intronic
1141261002 16:82453835-82453857 AAGCAGTTAAGGCATGAGGAGGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141789063 16:86220875-86220897 AAGGAGAGAGAGCATGAAGAAGG - Intergenic
1141801472 16:86312324-86312346 AAAGAGATAGAGGCTGAGCACGG - Intergenic
1141943124 16:87291573-87291595 ATGGAGGTAGACCATGGGGAGGG - Intronic
1142928344 17:3260422-3260444 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
1143340444 17:6206869-6206891 AGTGGGATAGAGCATGAGGCAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143701140 17:8661045-8661067 AAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1143728839 17:8868403-8868425 GAGGGGATAAAGCATGAGGTTGG - Intergenic
1143965797 17:10755837-10755859 AGGGAGAGAGAGGAGGAGGAAGG - Intergenic
1144045724 17:11452931-11452953 AAGGAGAGGGAGGAAGAGGAGGG - Intronic
1144465480 17:15493595-15493617 GGGGAGAGAGAGCAGGAGGATGG - Intronic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144641383 17:16939228-16939250 AGAGAGATAGAGCAGGAGGTCGG - Exonic
1144646149 17:16974929-16974951 AAGGAGAAAGAGGAGAAGGAAGG + Intergenic
1146110003 17:30080728-30080750 GAGGAAAAAGAGTATGAGGATGG - Intronic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146531309 17:33609853-33609875 AAGGAGAGAGGGGTTGAGGAAGG + Intronic
1146696471 17:34912354-34912376 AAGCAGATAGAGCAAGGGGTAGG + Intergenic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147511907 17:41077067-41077089 AGGGAAATAGAGAAAGAGGAAGG + Intergenic
1147575133 17:41594612-41594634 GAGGAGGGAGAGCAGGAGGAAGG + Intergenic
1147847002 17:43411582-43411604 AAGGAGAAAGAGCAAGAGAAGGG - Intergenic
1148079602 17:44960399-44960421 GAGGAGAGAGAGGATGAGAAGGG + Intronic
1148676086 17:49445838-49445860 AAGGACAGAGAGCAGGAAGAGGG - Intronic
1148720282 17:49747645-49747667 AAGTAGATAGAGCTTGACTAAGG - Intronic
1148752366 17:49952614-49952636 AAGGAGGTACAGCTAGAGGAAGG - Intergenic
1148769712 17:50059902-50059924 AGGGAGAGAGAGAATGAGAAAGG - Intronic
1148807081 17:50269357-50269379 AAGCAGAAAGAGTAAGAGGAGGG + Intergenic
1149121787 17:53177102-53177124 AAGGAGGTGGAGGAAGAGGAGGG - Intergenic
1149934198 17:60787639-60787661 AAGGAGATAGAGTAGGAGGGAGG + Intronic
1150078326 17:62213364-62213386 AAAGAAATAGAGAAAGAGGAAGG - Intergenic
1151398963 17:73843317-73843339 GGGGAGATGGAGCATGAGAAAGG + Intergenic
1151429822 17:74054961-74054983 AAGGAGAGAGAGAAAGGGGAGGG - Intergenic
1152228009 17:79101659-79101681 AAGGAGAGAGAGGAAGAGGGAGG + Intronic
1152441372 17:80312273-80312295 AAGGAGAGGGAGGAAGAGGAAGG + Intronic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153550800 18:6259583-6259605 AAGGAGATGGAGAAGGAGAAAGG - Intronic
1153933379 18:9898914-9898936 AGGGAGATATGGCATGGGGAAGG + Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1154438606 18:14366265-14366287 AAGACGATAAAGTATGAGGAAGG + Intergenic
1155041427 18:22068472-22068494 AAGGAGACAAAGCTTGAGCAGGG + Intergenic
1155119629 18:22805070-22805092 AAGGAGAAGGAGCATGTGTAAGG + Intronic
1155306127 18:24480380-24480402 AAGGAGAGAGAGCTTGTGCAGGG + Intergenic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1155649374 18:28121967-28121989 AAGGTGATAGAAAATGAGGGTGG + Intronic
1156126542 18:33912221-33912243 AAAAAGATTGAGAATGAGGAAGG - Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156791699 18:40983823-40983845 AAGGAGGTGGAGAAGGAGGAGGG - Intergenic
1156848800 18:41701469-41701491 ATGGAGATAGAGCAGGAGAGAGG - Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1156966493 18:43100363-43100385 AAGTAGAGAGAGCAAGAGGGAGG + Intronic
1156981744 18:43297983-43298005 AAGGAGATAGAAGATGTGAAGGG + Intergenic
1157261853 18:46182402-46182424 AAGGAGATAGAAAATGACCAGGG + Intronic
1157750121 18:50170995-50171017 AAGGAGAGAGAGCCTCAGGGAGG - Intronic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158555646 18:58472555-58472577 AAGGATAAAGAGCCTGGGGAGGG + Intergenic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1159121973 18:64181539-64181561 AATGAAATATAGCATGCGGAAGG - Intergenic
1159268188 18:66111643-66111665 AAGGAGACAGAGAGAGAGGAAGG + Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1160033162 18:75279558-75279580 GAGGAGCTGGAGCAGGAGGACGG + Intronic
1160078550 18:75702249-75702271 AAAGAGAAAGAGCATGACTATGG + Intergenic
1160143348 18:76345945-76345967 AAGTGGATAGAGCATGATAAGGG + Intergenic
1160871129 19:1278520-1278542 ATGGAGTCAGAGCATGCGGAGGG - Intronic
1161494170 19:4578696-4578718 AAGGTTATAGAGCAGGGGGAGGG - Intergenic
1162104710 19:8363444-8363466 AAGGAAAGAGAGAAAGAGGAAGG - Intronic
1162316144 19:9939283-9939305 AAGGAGATAGAAGAATAGGATGG - Intergenic
1162612681 19:11768191-11768213 GAGGAGAGAAAGCCTGAGGAAGG - Intronic
1162846637 19:13397817-13397839 AAGGGAAAAGAGCATGAGAAGGG - Intronic
1163398168 19:17076053-17076075 AAGGAGAAAGTGGATGGGGATGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163953653 19:20613959-20613981 AAGGAGAAAGAGTGTGAGAAGGG + Intronic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1164863593 19:31583437-31583459 GAGGAGAGAGAGCAAGAGGAGGG + Intergenic
1165361939 19:35342091-35342113 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1166317328 19:41996485-41996507 GAGGAGAGAGTGCATGAGGGGGG - Intronic
1166357564 19:42236190-42236212 AAGGAGTTAGGGCTGGAGGAAGG - Intronic
1166473951 19:43104456-43104478 AAGGAGAGAGAGAGAGAGGAAGG + Intronic
1167163353 19:47781434-47781456 AAGGAGTCAGAGCATGGGGCAGG - Intronic
1167319214 19:48785560-48785582 AGGGAGAAAGAGCTAGAGGAGGG + Intergenic
1167564181 19:50246029-50246051 AAGGAGGGAGGGCAGGAGGAAGG - Intronic
1167608486 19:50494359-50494381 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1168005376 19:53482529-53482551 AGGGACATAGAGTAAGAGGAGGG - Intronic
1168205441 19:54847241-54847263 AAGGAGAAAGAAGAGGAGGATGG - Intronic
1168236448 19:55066674-55066696 AAGGAGAGAGAGGAAGAGGAAGG - Intronic
1168517112 19:57017662-57017684 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1168517152 19:57017763-57017785 AGGGAGATGGGGGATGAGGAGGG - Intergenic
925030047 2:643351-643373 AAGAAGAGAGAGGATGAGAAAGG + Intergenic
925228637 2:2209424-2209446 ACGGAGATAGAGTAGAAGGATGG - Intronic
926174127 2:10573895-10573917 AAGGAAGCAGAGCACGAGGAAGG - Intronic
926528516 2:14012115-14012137 AAGGAGATGGTGCAGGAAGAAGG - Intergenic
926544135 2:14217954-14217976 AAGGAGGTAGAGGAGGTGGAAGG + Intergenic
926755937 2:16235878-16235900 GAGGAGATAGAGGATGTTGATGG + Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
927683310 2:25154363-25154385 AAGGAGATGGGGTCTGAGGAGGG + Exonic
928454711 2:31409104-31409126 ATGGAGATAGAGTAGAAGGATGG + Intronic
929144456 2:38694493-38694515 AGGGAGAGAGAGAAAGAGGAAGG + Intronic
929819933 2:45264829-45264851 AAGGGGACAGAGCAAGTGGAAGG - Intergenic
930262777 2:49166649-49166671 AAGGAGGTGAGGCATGAGGAGGG + Intergenic
930927630 2:56838530-56838552 AGAGAGAGAGAGCATGGGGAGGG + Intergenic
931814361 2:65886104-65886126 GAGGTGATAGATCATGGGGATGG + Intergenic
932091812 2:68812482-68812504 GAGGAGTTAGGGCATGAGGCAGG - Intronic
932322640 2:70833486-70833508 AAGGAGAGAGGGCTTGAGGTTGG - Intronic
932439349 2:71722266-71722288 AAGGAGATAATGCTGGAGGATGG + Intergenic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932744460 2:74321322-74321344 CAGGAGAAAGAACCTGAGGAAGG + Intronic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
933388670 2:81643749-81643771 ATGGAGACAGAGTATAAGGATGG + Intergenic
935028618 2:99301422-99301444 AAGGAGAGAGAGAGTGAGAAGGG + Intronic
935029369 2:99307083-99307105 AAGGAGAGAGAGAGTGAGAAGGG - Intronic
935451299 2:103212902-103212924 TAAGAGATAGATCAAGAGGAAGG - Intergenic
935982397 2:108640241-108640263 AAGGACATGGAGCCTGGGGAAGG - Intronic
936549068 2:113419324-113419346 AGGGAGATAGAGTAGGATGATGG + Intergenic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
936970895 2:118175297-118175319 ATGGAGGTAGAGGATTAGGAAGG + Intergenic
937160845 2:119759828-119759850 GAAGAGATAGAGGAGGAGGAGGG + Exonic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937600489 2:123725743-123725765 AAGGAGATTGAGCTGCAGGAAGG - Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938143103 2:128812417-128812439 GAGGAGGAAGGGCATGAGGATGG + Intergenic
938982549 2:136540275-136540297 CAGGAGAGAGAGCATGAAGTGGG - Intergenic
940647477 2:156406794-156406816 AAGAAGAAAGAGCTTTAGGAAGG - Intergenic
940754600 2:157667675-157667697 AATGAGATAGAGCCTGAATAGGG + Intergenic
941282283 2:163567922-163567944 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
941606915 2:167609416-167609438 AAGGAAACAGAGCATAAGGTAGG + Intergenic
941672403 2:168309229-168309251 GAGGAGGTAGAGAAAGAGGAAGG - Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942365620 2:175223187-175223209 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
942629388 2:177939354-177939376 AAGGAGGGAGAGAGTGAGGAAGG + Intronic
942651664 2:178175216-178175238 AAGCTGATAGAGCATATGGAAGG - Intergenic
942852634 2:180508176-180508198 AAGGAGATAGAGTAGAAGGATGG - Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943427719 2:187757768-187757790 AAGGAGGTAGAGAAAGAGAAAGG - Intergenic
943600904 2:189919862-189919884 AGGCAGATAGAGGAAGAGGATGG - Intronic
943812462 2:192205474-192205496 AATGAAATTGAGCATCAGGAAGG - Intergenic
944027987 2:195194887-195194909 AAGGAGATAGAGAAAGATAAAGG + Intergenic
945590918 2:211730456-211730478 GAGGAGATAGGGAAAGAGGAAGG - Intronic
945643403 2:212460078-212460100 AAGGAGAGAGAGCTTGTGCAGGG - Intronic
946167308 2:217872385-217872407 AAGGAAACAGAGGATGTGGATGG + Intronic
946368367 2:219265105-219265127 AAGGAGATAAAGACCGAGGAGGG + Intronic
946542544 2:220700790-220700812 AAGCAGGAAGAGCAGGAGGAAGG - Intergenic
946872591 2:224097698-224097720 AAGGAGAAAGTGCAAGAGGCTGG - Intergenic
946955463 2:224924935-224924957 AAGGAAATAGAGCAACTGGAAGG - Intronic
947292382 2:228590614-228590636 AAGAAGAGAGAGAATTAGGAAGG + Intergenic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947708226 2:232293493-232293515 AAGCAGGTGGAGCATGAGGAAGG + Intronic
947893070 2:233643523-233643545 AGGGGGATAGAGCATCAAGAGGG - Intronic
947901837 2:233727645-233727667 AAGGACATAGAGCACTAGAAAGG - Intronic
948233221 2:236366801-236366823 AAAGAGAGAGAGGAGGAGGAAGG - Intronic
948254305 2:236554778-236554800 AGAGAGATACAGCAGGAGGAAGG - Intergenic
948275590 2:236705605-236705627 AAGGAGCCAGTGCAGGAGGAGGG - Intergenic
948447136 2:238041418-238041440 ACTGAGAGGGAGCATGAGGACGG - Exonic
949081138 2:242100596-242100618 AAGGAGGTGGTGGATGAGGAAGG + Intergenic
1168742055 20:200366-200388 AAGGAGGTAGAGCATCAGGTGGG - Intergenic
1168867138 20:1096622-1096644 AAGGGGAGGGAACATGAGGAGGG - Intergenic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169368990 20:5014135-5014157 AAGAAGATAAAGGATGAAGAAGG + Intergenic
1170356318 20:15495939-15495961 AAGAGGAAAGAGCATGAGCAAGG + Intronic
1170366179 20:15600501-15600523 AAAGAGATAGAGAAAGAAGAAGG - Intronic
1172038498 20:32027295-32027317 AAGGGCATACAGTATGAGGAAGG - Intronic
1172657213 20:36544479-36544501 AAGGAGATAAAGCATGGTAATGG + Intronic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1173040772 20:39460264-39460286 AAAGAGATGGGGCATGGGGAGGG + Intergenic
1173879671 20:46402556-46402578 AAGGAGATGGAGCTTGGGTAGGG + Intronic
1173927378 20:46790956-46790978 CAAGAGAGAGAGCAAGAGGAGGG + Intergenic
1174003168 20:47389633-47389655 AGGCAGATAGATCATGAGGTTGG - Intergenic
1174018422 20:47508504-47508526 AAGAAGAGAAAGCATGGGGAGGG + Intronic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175013719 20:55765836-55765858 CAGGAGAGAGAGCATGAAGGAGG + Intergenic
1175929702 20:62487874-62487896 GAAGAGAAAGAGCAAGAGGAAGG - Intergenic
1176457076 21:6923214-6923236 AAGATGATAAAGTATGAGGAAGG - Intergenic
1176835249 21:13788296-13788318 AAGATGATAAAGTATGAGGAAGG - Intergenic
1176914433 21:14608242-14608264 CAGGAGATAGAGGAGGAGGGTGG - Intronic
1176970260 21:15256624-15256646 AAGATGATAGAGCATAAAGAAGG + Intergenic
1177024233 21:15902427-15902449 ATGGAGATAGAGTAGAAGGATGG + Intergenic
1177026704 21:15929652-15929674 AAGAAAATAGAGCATGAGTAAGG + Intergenic
1177144897 21:17396944-17396966 AAGGAGATTCAACATGAGAAAGG + Intergenic
1177456487 21:21345664-21345686 AAGGAGATAGAGAAAGAGATAGG + Intronic
1178070363 21:28958906-28958928 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1178100824 21:29266779-29266801 AAGGAGATAGCATCTGAGGAAGG - Intronic
1178139640 21:29668311-29668333 AGGGATATAGAGAATGAGAAGGG + Intronic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1181539920 22:23567541-23567563 GAGGAGGGAGAGCAAGAGGAAGG + Intergenic
1181639497 22:24189244-24189266 ATGGAGAGAGAGCCTGGGGAGGG - Intergenic
1181883399 22:25999576-25999598 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182567396 22:31210578-31210600 AATGTGAGAGAGAATGAGGAGGG + Intergenic
1182836964 22:33350053-33350075 AAGGAGGTAGAGGCTAAGGAGGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183328080 22:37205107-37205129 AGGATGATAGAGCATGGGGAGGG + Exonic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1184449734 22:44575843-44575865 AGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184525263 22:45019049-45019071 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1184566834 22:45297097-45297119 AAGGAGATGAGGCATGAGGGTGG + Intergenic
1185180360 22:49356791-49356813 AAGGAATTAGGTCATGAGGATGG - Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949310444 3:2691390-2691412 AAGAAGAAAGAGGAAGAGGAGGG + Intronic
949362777 3:3249298-3249320 CAGAAGATAGAGCTTGAGAAAGG - Intergenic
949576814 3:5346135-5346157 AGGGAGGGAGAGCATCAGGAAGG + Intergenic
950284494 3:11733970-11733992 ATGGAGAAAGAGCATGGAGAAGG + Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950856718 3:16112599-16112621 AAAGAGAGAGAGCATGTGCAGGG + Intergenic
951285360 3:20805655-20805677 AAGCAGACAAAGCATTAGGAAGG + Intergenic
951559213 3:23948860-23948882 AAGGAGATACTGCATGTGTATGG + Intronic
951653772 3:24981854-24981876 AGGGAGATAGAGGCAGAGGATGG - Intergenic
951840145 3:27025613-27025635 GAGAAGAGAAAGCATGAGGAGGG - Intergenic
952000565 3:28781115-28781137 ATGGAGAGAGGGCAAGAGGAAGG + Intergenic
952139330 3:30460428-30460450 ATGGAGATAGAGTAGAAGGATGG + Intergenic
952557775 3:34552934-34552956 AAGGAGGAAGGGCAGGAGGAGGG - Intergenic
952719291 3:36515468-36515490 AAGGGGAAAGGGCATCAGGAAGG + Intronic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953806543 3:46074719-46074741 AAGGAGGAAGAGGAAGAGGAGGG + Intergenic
953887043 3:46720014-46720036 AAGGAGGGAGGGCATAAGGATGG + Intronic
955151033 3:56367435-56367457 AAGGAGATAGATCAGGATAAGGG - Intronic
955152434 3:56381624-56381646 AAGGAGAAAGACCAAAAGGAGGG + Intronic
955490844 3:59480636-59480658 AAGTAGACCGGGCATGAGGAAGG - Intergenic
955628310 3:60945064-60945086 AAAGAGATGGAGGATGATGAGGG + Intronic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956636683 3:71371837-71371859 AAGGAGGTAGGGAGTGAGGATGG - Intronic
956665412 3:71637534-71637556 AAGGAGAAAGAGGGGGAGGAGGG + Intergenic
957162900 3:76633509-76633531 AAGGAGAAAGAAGATGAGAAAGG + Intronic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
958065813 3:88543983-88544005 AAAGAGAGAGAGCATGTGCAGGG - Intergenic
958736545 3:98016031-98016053 CAGGAGAGAGAGCATGTGCAGGG + Intronic
959603267 3:108212956-108212978 AAGGAAGAAGAGCAAGAGGAAGG - Intronic
959645437 3:108694533-108694555 AAGGAGAGAGAGCTTGTGCAGGG + Exonic
959963832 3:112332291-112332313 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960456625 3:117880469-117880491 AGGGAGAAAGGGCATAAGGAAGG - Intergenic
960581605 3:119283610-119283632 CAGGAGACAGAGAATGAGGGAGG - Intergenic
961040690 3:123676041-123676063 CAGGACACAGAGCATCAGGATGG + Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961702145 3:128753347-128753369 AAGCAGATAGAGGATGAAGGGGG + Intronic
962177762 3:133172909-133172931 AAAGAGAGAGAGCTTGTGGAGGG - Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962629976 3:137265664-137265686 CAGGAAATAGAGCATGAGGCTGG + Intergenic
963513809 3:146282354-146282376 AAGAAGAGAGAGAATGAAGAAGG + Intergenic
963957403 3:151270009-151270031 AAGGAGATAAATGATGAAGAAGG + Intronic
964235701 3:154524364-154524386 AAGGGGATGGAGCATGGTGAAGG - Intergenic
964304508 3:155326086-155326108 ACGGCCATAGAGCATGAGGAGGG + Intergenic
964421861 3:156511696-156511718 AAGTAGAAAGAGCTTGAGGAAGG - Intronic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
964738597 3:159942141-159942163 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
965028609 3:163334793-163334815 CAAGAGAGAGAGCATGTGGAAGG + Intergenic
965253470 3:166371856-166371878 GAGGAAATAATGCATGAGGAGGG + Intergenic
965709776 3:171545602-171545624 AAAGAGACAGAGCATGGGGCAGG - Intergenic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966047414 3:175569545-175569567 AAGTACATAGGTCATGAGGATGG + Intronic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966647152 3:182259452-182259474 AAGGAGATAAAGTATGGGAAAGG + Intergenic
966767747 3:183478308-183478330 TAGGAGACAAAGCAGGAGGAGGG - Intergenic
967036021 3:185648869-185648891 CAGAAGATAGAGCCTGTGGAGGG + Intronic
967289410 3:187904542-187904564 AAGGAGTGAGATCATGAAGATGG - Intergenic
968058921 3:195713331-195713353 GAGGAGTTAGGGCAGGAGGACGG - Intergenic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
969194774 4:5551865-5551887 AAAGAGAAAGAGCATGTGCAGGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970573488 4:17405264-17405286 AAGGAGGAAGAGGAAGAGGAAGG + Intergenic
970632143 4:17959500-17959522 AATGAGATAGAGCATAAAAAAGG + Intronic
971223434 4:24730173-24730195 AAAGAGATAGAGTTTGAGGGCGG + Intergenic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971514355 4:27467954-27467976 AAAGAAAAAGAGGATGAGGAAGG - Intergenic
971643159 4:29161680-29161702 TAGGAGAGAGAGCATGAAGAGGG - Intergenic
971689569 4:29815399-29815421 AGTGAGATAGGGCAGGAGGAGGG + Intergenic
971753452 4:30679265-30679287 AAAGAGAGAGAGCTTGTGGAGGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972648726 4:40994855-40994877 AAGGAGAGAGAGAAGGAGGGAGG + Intronic
973307610 4:48670627-48670649 ATGGAGATAGAGTAGAAGGATGG - Intronic
973738705 4:53898839-53898861 AAGTAGACATAGTATGAGGAGGG + Intronic
973790187 4:54371042-54371064 AAGGATTCAGGGCATGAGGATGG + Intergenic
973960589 4:56105978-56106000 ACGGAGACAGAGCTTGGGGATGG - Intergenic
974230032 4:59100059-59100081 AAGGAGAGAGAGCTTGTGCAGGG + Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974304968 4:60124402-60124424 AAGGAGGTAGAGAATGAGGTAGG + Intergenic
974381567 4:61147035-61147057 AAAGAGAAAGAGCACAAGGAAGG + Intergenic
974555704 4:63445312-63445334 AAAGAGAGAGAGCATGTGCAGGG + Intergenic
975231484 4:71939399-71939421 GGGGAGATAGAGAAAGAGGAAGG - Intergenic
975504449 4:75122849-75122871 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
975902635 4:79170725-79170747 AAGGAGAGAAAGCCTGAGGCTGG - Intergenic
975988527 4:80231083-80231105 AAGGAGATAATACGTGAGGAAGG - Intergenic
976361948 4:84190118-84190140 GAGGAGATGGGGCTTGAGGAAGG + Intergenic
976515992 4:85967059-85967081 ATGGGGATAGAGAATGAGCAAGG + Intronic
976987274 4:91317434-91317456 AAGGTGAAAGAGAATGGGGAGGG - Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977491849 4:97723787-97723809 TAGGAGAGAGAGCATGAAGAGGG + Intronic
978028791 4:103912423-103912445 AAGGAGATGGAGTATCAGGGAGG - Intergenic
978268543 4:106859006-106859028 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
978549516 4:109910370-109910392 AAGGACATAGAGAAGGAGAAGGG - Intergenic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
980161271 4:129166240-129166262 AAGGAAATCGAGCATTAGTAGGG - Intergenic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
981106692 4:140889751-140889773 AAGGAGTTAGAGAATGACCAGGG - Intronic
981246239 4:142542173-142542195 AAGGAGATAGAGCATCCAAAGGG - Intronic
981399054 4:144290571-144290593 AAGGACCTAGAGGATGAGGAGGG + Intergenic
981611578 4:146598767-146598789 AGGAAGACAGAGCATGAGCAGGG + Intergenic
981989881 4:150905363-150905385 AAAGAGAGAGAGCAGGAGCAGGG + Intronic
982392640 4:154882316-154882338 AAGGAGATAGGGAAGGAGGAAGG + Intergenic
982457495 4:155627943-155627965 AAAGAGATATAGCATGAAGCTGG + Intergenic
983307935 4:166017678-166017700 AAAGAGAAAGAACAAGAGGAAGG - Intronic
983381013 4:166993487-166993509 AAAGAGAAATAGCATGAGGGTGG - Intronic
984235801 4:177157204-177157226 AAGGAGACAGAACATCATGAGGG + Intergenic
984419111 4:179496850-179496872 AAGGAGAAAGAGGAGGAGGTGGG + Intergenic
984483261 4:180333266-180333288 CAGGACATAGAGAATGAGAATGG + Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
985850487 5:2385020-2385042 CAGGAGCTTGGGCATGAGGAGGG - Intergenic
987015216 5:13811044-13811066 ATGGAGATAGAGTAGAAGGATGG + Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987042078 5:14072388-14072410 ATGGAGATAGAAGATGGGGAAGG - Intergenic
987515046 5:18895109-18895131 AATGCCAAAGAGCATGAGGATGG - Intergenic
987611984 5:20216868-20216890 AAGCAGAAAGAGCAAGAGCAAGG + Intronic
988360387 5:30229870-30229892 AAAGAGAGAGAGGAGGAGGAAGG + Intergenic
988432306 5:31133550-31133572 AAGGAGAAAGTGTATGAGAAAGG - Intergenic
988649298 5:33130839-33130861 AAGAAGAGAGAGCTTGTGGAGGG - Intergenic
989134943 5:38144454-38144476 AAGGAAATAGAGAAAGAGGAAGG - Intergenic
989151317 5:38302387-38302409 AAGGTCATGGAGCAGGAGGATGG - Intronic
989227465 5:39046745-39046767 AAGGATATGGAACAGGAGGAGGG - Intronic
990005148 5:50937268-50937290 AAGGTGAGAGAGCAGGAGAAAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990206642 5:53436759-53436781 AAGAAACTAGAGCATGAGGAAGG - Intergenic
990317835 5:54600841-54600863 AGGGAGAGAGAGTATTAGGAAGG + Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990767494 5:59202718-59202740 AAAGAGAGAGAGCTTGAGCAGGG - Intronic
990822431 5:59857851-59857873 AAGGAGGGAGAGCAGAAGGAAGG + Intronic
990829955 5:59944841-59944863 AAGGAGGAAGAGCAGGAAGAGGG - Intronic
990867362 5:60395075-60395097 ATTAAGATGGAGCATGAGGAAGG - Intronic
991960202 5:72036768-72036790 AAGGAAACAGAGCAGGAGAATGG + Intergenic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992829337 5:80579109-80579131 AAGGAGAGAGAGCGGGAGGGAGG + Intergenic
992985493 5:82224658-82224680 AAGGAGATAGAGTGAAAGGAGGG + Intronic
993007139 5:82440926-82440948 AAGCAGGTAGAGGAGGAGGATGG - Intergenic
993176648 5:84494879-84494901 CAGGAGAGAGAGCAAGAGCAAGG + Intergenic
993306998 5:86286322-86286344 AAAGACATAGAGAATGAGGCTGG - Intergenic
993407439 5:87529113-87529135 ATGGAAAAAGAGCATGAGAATGG + Intergenic
993407526 5:87529882-87529904 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
993596914 5:89868897-89868919 AAGGAGAGAGATTATGGGGAGGG + Intergenic
993765960 5:91858878-91858900 AAAGAGAGAGAGCACGAGGGGGG + Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994527786 5:100928270-100928292 AAGAAGGTAGAACATGAGAATGG - Intergenic
994624299 5:102198645-102198667 ATGGATTGAGAGCATGAGGAAGG + Intergenic
995436019 5:112136219-112136241 AGGGAGATAGAGCGTAAGGGAGG + Intergenic
995558106 5:113351505-113351527 ATGGAGATAGAGGATAAGGATGG + Intronic
995657443 5:114442886-114442908 AAGAACATAGTGCATGAGCATGG + Intronic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
996291948 5:121861663-121861685 AAGGAGAAAGAGGGTAAGGATGG + Intergenic
997251261 5:132390308-132390330 AAGGAGCTAGAGAATGAGTCAGG - Intronic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
998015600 5:138729509-138729531 AAGGAGGTGGAGAATGAGGGAGG + Intronic
998157455 5:139795125-139795147 AAGGAGAAAGAACCTGAGGGAGG - Intergenic
998522916 5:142816975-142816997 GAGGAGAGAGAGCACGTGGATGG + Intronic
998669012 5:144332686-144332708 AAGGAGTTAGGGGTTGAGGAGGG + Intronic
998756625 5:145388077-145388099 CAAGAGATAAAGGATGAGGATGG + Intergenic
998932157 5:147193446-147193468 AAGGAGAAAGAGCAAGCAGAAGG + Intergenic
999084183 5:148872642-148872664 AAGGAGAAAGAGCATGAGATCGG + Intergenic
999573473 5:152946971-152946993 AGGAAGGTAGAGCATGAGGCTGG - Intergenic
1000111991 5:158117054-158117076 AAAGAGAAAGAGGAAGAGGAAGG - Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000406238 5:160891366-160891388 AAGGTCAGAGAGAATGAGGAAGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001040042 5:168327936-168327958 AAGAAGTTAGAGCATGTGGGTGG + Intronic
1001165832 5:169366019-169366041 AGTGAGATAGGGCATGAGAAGGG - Intergenic
1001253352 5:170165374-170165396 AGGGAGGGAGAGCAGGAGGAAGG - Intergenic
1002795097 6:465638-465660 AAGGAGAAAGAGGATGGGGCAGG - Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1004180161 6:13374406-13374428 AAGGAGACTGAGCAGGAGAATGG - Intronic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004334271 6:14750070-14750092 GAGCAGGAAGAGCATGAGGAAGG - Intergenic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1006202950 6:32313086-32313108 AAGGAGGCAGAGCAGGAGGTAGG - Intronic
1006203607 6:32319566-32319588 AAGGAGGCAGAGCAGGAGGTAGG - Intronic
1006896605 6:37475346-37475368 AAGGACATCGAGGATGTGGATGG - Exonic
1007081428 6:39107864-39107886 AAGGAGGGAGGGCATGAGGGTGG + Intronic
1007234416 6:40379977-40379999 AGGGAGATGGACCATGGGGAGGG + Intergenic
1007241013 6:40425220-40425242 AAGGAGAGAGACCCTGAAGATGG - Intronic
1007626751 6:43251039-43251061 AAGGAGACAGGGAAAGAGGAAGG - Intronic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1007907333 6:45475202-45475224 AAAGTGATAGAACATGAGAAAGG + Intronic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008565664 6:52765884-52765906 CAGGAGCCAGAGCATAAGGAAGG + Intergenic
1008809103 6:55470821-55470843 CAGGAGAGAGAGCATGAAGAGGG + Intronic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1009671258 6:66753889-66753911 AAAGAGAGAGAGAATGAGGGAGG + Intergenic
1010052359 6:71521909-71521931 AAGGAGATAGAGATTGGGGATGG - Intergenic
1010966372 6:82213850-82213872 AGGGAGAGAGAGGAAGAGGAGGG + Intronic
1011152151 6:84286303-84286325 AGGGAGAGAGAGAAAGAGGAAGG - Intergenic
1011172620 6:84522724-84522746 AGGGAGAAAGAGCCTGAGAATGG - Intergenic
1011183589 6:84649599-84649621 AAGGAAATAGATCATGAGGGTGG + Intergenic
1012032780 6:94093800-94093822 TAGGAGATGGAGGATGTGGAAGG - Intergenic
1012202673 6:96425175-96425197 AAGGCAAGAGAGCATGAGCAGGG + Intergenic
1012604878 6:101145400-101145422 AAAGAGATAGAAAATGATGATGG + Intergenic
1012883059 6:104814786-104814808 AGGGAGAAAGAGCGTGAGGGGGG - Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013633083 6:112003774-112003796 AAGGAGAGAGAGAAAGAGAAGGG + Intergenic
1013954610 6:115826518-115826540 AAGGAAATAGAGCAGAATGATGG + Intergenic
1014140936 6:117941074-117941096 AAGGAGATAAACCATGACCAGGG - Intronic
1014726326 6:124976266-124976288 AAGGAGAGAGAGCGGGAGGGAGG - Intronic
1014894787 6:126888703-126888725 TAGAAGATACAACATGAGGAAGG - Intergenic
1014980649 6:127942682-127942704 AAAGAGAGAGAGCTTGTGGAGGG + Intergenic
1015192865 6:130490644-130490666 AAGGAAGGAGAGCATCAGGAAGG - Intergenic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1015207338 6:130654985-130655007 AATGAGAAAGAGCGTGTGGAAGG + Intergenic
1015373119 6:132478803-132478825 AAGGACAGAGAACATGAGAAAGG + Intronic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015476324 6:133662206-133662228 AAGGAGAAAGAGCTTGTGCAGGG - Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015799615 6:137046910-137046932 AAGGAGATAGAAGATGGGGCAGG + Intergenic
1016030842 6:139336247-139336269 AATGAGATAGACCAGGAGGCTGG + Intergenic
1016277009 6:142365685-142365707 AGGGAGGAAGAGCAGGAGGAGGG + Intronic
1016497622 6:144682176-144682198 ATGGAGATAGAGTAGAAGGATGG - Intronic
1016624536 6:146150737-146150759 ATGGAGATAGAGTAGAAGGATGG - Intronic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017470003 6:154730484-154730506 AAGGCGATAAAGCAAGAGAAGGG - Intergenic
1019021979 6:168927078-168927100 AAGGCGACATAGCATTAGGAAGG + Intergenic
1019389994 7:781205-781227 ATGGAGATAGAGCAGAAGGATGG - Intronic
1020179262 7:5908724-5908746 AAGGAGACAGACAATGAGGCTGG - Intronic
1020256306 7:6504540-6504562 AAGGAGAGAGGGAATGAGGCTGG + Intronic
1020303672 7:6816131-6816153 AAGGAGACAGACAATGAGGCTGG + Intronic
1020413090 7:7915019-7915041 TAGAAGATAGGGCATGGGGAAGG + Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021128278 7:16880123-16880145 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1021188940 7:17598064-17598086 GATGAGATAGTGGATGAGGAAGG - Intergenic
1021847105 7:24774101-24774123 AAGGAGTTGGAGGATGAGCAGGG - Intergenic
1021934834 7:25620109-25620131 AGGGAGAGAGAGCAAGAGAAGGG - Intergenic
1022446287 7:30473267-30473289 AAGGAGAGGGAGGATGAGTAAGG + Intronic
1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG + Intronic
1022657263 7:32330950-32330972 AAGGAGACAGAGGAGGAGGGAGG - Intergenic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023474199 7:40559209-40559231 AAGGAGATGGAGCATCTGGCTGG - Intronic
1023616167 7:42022498-42022520 AAAGAGAGAGAGCAGGAGGAGGG + Intronic
1023681442 7:42691566-42691588 AAGGAGTAAGAGCAATAGGAAGG - Intergenic
1023795178 7:43786475-43786497 AAGGAGACAGAAAATCAGGAAGG + Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024978569 7:55136384-55136406 AGGGAGATAGAGGAGGAGGTGGG - Intronic
1025294795 7:57768891-57768913 GGGGAGACAGAGCAAGAGGAAGG - Intergenic
1026175322 7:67991535-67991557 AAGAAGATAGTGCAGGAGGCTGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026225769 7:68439186-68439208 ATGGAGATAGAGTAGCAGGATGG + Intergenic
1026566890 7:71496595-71496617 GAGGAGAGAGACCATGAGGGAGG + Intronic
1026837648 7:73649100-73649122 AGGGAGAGAGAGAAAGAGGAGGG - Intergenic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1029653973 7:101912244-101912266 ATGGAGATAGAGGAGGAGGAGGG - Intronic
1029914074 7:104188875-104188897 CAGGAGAGAGAGCATGAAGGGGG - Intronic
1030108357 7:106006093-106006115 AAAGAGATAGAGCTTGTGTAGGG + Intronic
1030172388 7:106616473-106616495 AAGGAGAGAGAGGAAGAGGAGGG + Intergenic
1030206502 7:106957141-106957163 AGAGAGAGAGAGGATGAGGAAGG + Intergenic
1030800302 7:113841992-113842014 ATGGGCACAGAGCATGAGGAGGG - Intergenic
1030868893 7:114732382-114732404 AAGGAGAGAGAGCTTGTGCAGGG - Intergenic
1030922570 7:115410284-115410306 ATGTAGATTGAGCATGTGGAGGG - Intergenic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1030944033 7:115694008-115694030 AGAGAGAGAGAGCATGAAGAGGG + Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031638946 7:124138863-124138885 AAGGAGATAGAGAAAGAGATAGG - Intergenic
1031678181 7:124636815-124636837 AAGTAAGTAGATCATGAGGATGG + Intergenic
1032053298 7:128663341-128663363 AAAGAGAGAGAGCTTGAGCAGGG - Intergenic
1033433740 7:141313407-141313429 AAGGAGACAGATCATGAACATGG - Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033619860 7:143052423-143052445 GAGAAGATAAAGCATGAGGAAGG - Exonic
1033761276 7:144439086-144439108 AGGGAGACAGAGCTTGAGAAAGG + Intergenic
1033996750 7:147359583-147359605 AAGGAGAAATAGCATGGGGTGGG - Intronic
1034060451 7:148082482-148082504 AAGGAGATAGAGGAGGAGTGTGG + Intronic
1034535007 7:151720968-151720990 AAGGAGATGGAGCAGGCAGAGGG + Intronic
1034609039 7:152348294-152348316 CAGGAGATAAAGCATAGGGAAGG + Intronic
1035122701 7:156581615-156581637 ATGGAGATAAAGCATCAAGATGG - Intergenic
1036164785 8:6422567-6422589 AAGGGGATAGAGAATGAGTCAGG - Intronic
1037203489 8:16286049-16286071 AATCAGATAGAGTATTAGGAAGG + Intronic
1037454708 8:19051993-19052015 AAAGTGATGGAGAATGAGGAAGG + Intronic
1037824684 8:22154350-22154372 ATAGAGATAGAGCATCAGGTAGG + Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038326806 8:26577972-26577994 AAGGAGAGAGAGAAACAGGAGGG - Exonic
1038812695 8:30866353-30866375 AAGGAGAAAGGGGAAGAGGAAGG + Intronic
1039273670 8:35911052-35911074 AAGAAGAAAGAGCATGTGCAGGG + Intergenic
1039320151 8:36420725-36420747 AAGGAGAAAGAACATGGGCAGGG - Intergenic
1039416770 8:37401907-37401929 AAGTAGATATGGCATGAGGAGGG - Intergenic
1040886046 8:52265197-52265219 AAGGAGATAGAGCAGGAGCCTGG + Intronic
1041225340 8:55692057-55692079 AGGGAGATAGAGCATGAGAGCGG - Intergenic
1041315529 8:56558108-56558130 AAGGAGATAGAGCAGGAGGGCGG - Intergenic
1041447373 8:57967091-57967113 AAGGAGATAGGGCATTTGGAAGG + Intergenic
1041985588 8:63918884-63918906 AAGAAGATACAGCATAAAGAAGG + Intergenic
1042082374 8:65069679-65069701 GAGGAGATAGAGAAAGAGGTAGG - Intergenic
1042397696 8:68311080-68311102 AAGGAGACAGGGAAGGAGGAAGG - Intronic
1042579152 8:70257513-70257535 AAGGAGAAAGAGCAGCAGGCAGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043020693 8:74996450-74996472 GAGGTGATAGAGAATGAGGGAGG + Intronic
1043256297 8:78141913-78141935 AAGGAGAAAGAGGAAGAAGATGG - Intergenic
1043305995 8:78796535-78796557 AAAGAGATAGTGCATGATAATGG + Intronic
1044152548 8:88799783-88799805 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1045582795 8:103499389-103499411 AAGGAGGGAGAACGTGAGGAGGG - Intergenic
1045623703 8:104015435-104015457 AAGGAGATAGAACCTTATGAAGG + Intronic
1045871425 8:106931945-106931967 CAGGAGAGAGAGCATGTGCAGGG + Intergenic
1046288231 8:112124493-112124515 AAGGAGATAAGGCATGGTGAAGG - Intergenic
1046649141 8:116817892-116817914 AAGGAGATTGTGGATGATGAAGG + Intronic
1047025951 8:120824795-120824817 AAGGAGAGAGAGGAGTAGGAAGG - Intergenic
1047919786 8:129622982-129623004 AAGGAGAAAGAACATGAGACTGG + Intergenic
1047953723 8:129957187-129957209 AAGAAAATAGAACATGAGAAAGG - Intronic
1048146620 8:131851244-131851266 AAGGAGAGAAAGCATCAGGGGGG - Intergenic
1048737060 8:137513584-137513606 AAGGACATAGATGATGGGGATGG + Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048808607 8:138264128-138264150 AAGGACAAAGAGCCTGAGGTGGG - Intronic
1048981478 8:139705156-139705178 AAGGAGATAAAGCCTGGAGAGGG - Intergenic
1049515019 8:143049704-143049726 AAGGAGGAGGAGCATAAGGAGGG - Intronic
1049903874 9:197526-197548 AGGGAGATAGAGTAAGATGATGG - Intergenic
1050188766 9:3002922-3002944 AAGGAGGGAGAGCAAGTGGAAGG - Intergenic
1050699930 9:8327588-8327610 AATGAGATAGAACATTAGCAAGG - Intronic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1052334580 9:27306602-27306624 AGGGAGATAGAATATGAGGCTGG - Intergenic
1052425882 9:28303844-28303866 AAGGAGATAGAAAAGGAGGCAGG + Intronic
1053746880 9:41207825-41207847 AGGGAGATAGAGTAGGATGATGG - Intergenic
1054161628 9:61675401-61675423 GGGGAGACAGAGCAAGAGGAAGG + Intergenic
1054480404 9:65657534-65657556 AGGGAGATAGAGTAGGATGATGG + Intergenic
1054681464 9:68223456-68223478 AGGGAGATAGAGTAGGATGATGG + Intergenic
1054734861 9:68740741-68740763 AAGGAAATACGCCATGAGGAAGG - Intronic
1054757759 9:68976499-68976521 AAGGAGCTACAGCAAGAGGCAGG - Intronic
1054999282 9:71430027-71430049 AGGGAGATAGAGAATGAGAGGGG - Intronic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055371181 9:75601352-75601374 AAGGAGAGAGAGAAGGAAGAAGG - Intergenic
1055485789 9:76755361-76755383 ATGGAGAGAGAGAATGAGGGAGG + Intronic
1055595465 9:77861157-77861179 AAAGAGAGAGAGCTTGAGCAGGG + Intronic
1056047701 9:82736258-82736280 AATGAGATAGAGACAGAGGAGGG - Intergenic
1056146103 9:83730895-83730917 AAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1056555662 9:87685225-87685247 AAGGAGAAAGGGCACTAGGAGGG - Intronic
1056597672 9:88021038-88021060 AAGGAGAGAGAGAAGAAGGAAGG - Intergenic
1056691310 9:88810921-88810943 AAGGAGAGAAAGCCTGAGGGTGG - Intergenic
1056771827 9:89483126-89483148 AAGGAACTGGAACATGAGGATGG + Intronic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1057778334 9:98028685-98028707 AGGGAGATAGACCATTAGGCAGG + Intergenic
1057851544 9:98570545-98570567 ATGGAGACAGAGCATGGGAAAGG - Intronic
1057861282 9:98642913-98642935 AGGGAGACAGTGCAGGAGGAGGG - Intronic
1058921374 9:109618581-109618603 AAGAAGAAATACCATGAGGATGG - Intergenic
1058969470 9:110067052-110067074 GGGAAGATAGAGAATGAGGAAGG + Intronic
1059072416 9:111152796-111152818 AAGGAGGCAGAGGAGGAGGAAGG + Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1060234438 9:121852603-121852625 AAGGTGACTGAGGATGAGGAAGG + Intronic
1060546537 9:124465176-124465198 AAGGAGAGAGACCAGGAGGATGG - Intronic
1060949791 9:127594448-127594470 AAGGAGACAGAGCATCAGAGGGG + Intergenic
1061216785 9:129226245-129226267 AAGGAGAGAGAACAGGAAGAGGG + Intergenic
1061276102 9:129570089-129570111 GAGGAGAGAGACCAAGAGGAAGG + Intergenic
1061348573 9:130045504-130045526 GAGGAGAAAGAGGAAGAGGAAGG + Intergenic
1061491087 9:130944600-130944622 GAGGGGAGAGAGCATGAGGTGGG + Intergenic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1202783011 9_KI270718v1_random:18605-18627 AGGGAGATAGAGTAGGATGATGG - Intergenic
1185495498 X:551264-551286 AAGGAGAGAGAGAGAGAGGAAGG - Intergenic
1185499060 X:583999-584021 AGGGAGACAGAGGAGGAGGAGGG + Intergenic
1185766903 X:2732922-2732944 AAGGAGAGAGGGAAGGAGGAAGG - Intronic
1185820126 X:3194897-3194919 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1186079322 X:5912969-5912991 AGGGAGGGAGAGCAGGAGGAAGG + Intronic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187284892 X:17895823-17895845 AAAGTGATAGAGAATGATGAGGG + Intergenic
1187622963 X:21079007-21079029 GAGGAGATGAAGCCTGAGGAGGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187667246 X:21627635-21627657 AAAGAGAGAGAGCTTGTGGAGGG + Intronic
1188706434 X:33338317-33338339 AAGCAAATGGAGCATGAGCATGG - Intronic
1188713430 X:33430656-33430678 AAGGAGAGAGGGCTTGAGCAGGG + Intergenic
1188747390 X:33862798-33862820 ATGGAGACAGAGCAGAAGGATGG - Intergenic
1189066245 X:37812362-37812384 AAGGAGAAAGAGCTGGGGGAAGG + Exonic
1189602195 X:42639191-42639213 GAGGAGAAAGAGGAAGAGGAAGG - Intergenic
1189868933 X:45361579-45361601 CAGGAGACAGAGCAAGATGATGG - Intergenic
1189898997 X:45686502-45686524 AGGGAGAGACAGCATGAAGAAGG - Intergenic
1190432064 X:50387731-50387753 AAAGAGAGAGAGGAGGAGGATGG - Intronic
1192432091 X:71119264-71119286 AAGGTGAAAGGGCAGGAGGAGGG - Intronic
1193112771 X:77746143-77746165 AAGGTGAGAGAGCAGGAGGTGGG + Intronic
1193221096 X:78928170-78928192 AAAGAGAGAGAGCATGTGCAGGG + Intergenic
1193221403 X:78930611-78930633 GAGGAGAGAGAAAATGAGGAGGG - Intergenic
1193570461 X:83135465-83135487 AAAGACATAGAGAATGTGGAAGG + Intergenic
1195089807 X:101448019-101448041 ATGGAGATAGAGTAGAAGGATGG - Intronic
1195664336 X:107415207-107415229 GAGGAGGTGGAGGATGAGGAGGG + Intergenic
1196886105 X:120246961-120246983 AAAGGGATAGAGAATGATGAGGG - Intergenic
1197048494 X:122029365-122029387 ATGGAGAGAGAGCAACAGGAAGG + Intergenic
1197436508 X:126434838-126434860 GAGGAGATAGAGGAGGGGGAAGG + Intergenic
1197492161 X:127130556-127130578 GAGGAGATAGAGAAAGAGAAAGG + Intergenic
1197526732 X:127573927-127573949 ATGGAGATAGAGTAGAAGGATGG - Intergenic
1197610718 X:128635352-128635374 AGGTAGATAGATAATGAGGAAGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198380723 X:136080836-136080858 AAGGAGATAGAGAAGGAGATGGG - Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199393141 X:147305485-147305507 AAGGAGGTGGAGCAAGATGATGG + Intergenic
1199396167 X:147341192-147341214 AAGGAGAGAGGGAAGGAGGAAGG - Intergenic
1199862791 X:151816871-151816893 TAGGAGAAAGAGCAGGAGAAAGG - Intergenic
1200160807 X:154007672-154007694 CAGGAGAGAGAGCATGACGGAGG + Intergenic
1201637791 Y:16144488-16144510 GACGAGATAGAGGAGGAGGAGGG + Intergenic
1202025187 Y:20514422-20514444 AAAGAAATAGAGAATGTGGAAGG + Intergenic