ID: 1126326112

View in Genome Browser
Species Human (GRCh38)
Location 15:47479333-47479355
Sequence ATAGAGAAACAGGTTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 1, 2: 1, 3: 54, 4: 526}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126326112_1126326115 -5 Left 1126326112 15:47479333-47479355 CCATCCTCAACCTGTTTCTCTAT 0: 1
1: 1
2: 1
3: 54
4: 526
Right 1126326115 15:47479351-47479373 TCTATGCTAAGTTCAGTAAGAGG 0: 1
1: 0
2: 1
3: 5
4: 113
1126326112_1126326116 -1 Left 1126326112 15:47479333-47479355 CCATCCTCAACCTGTTTCTCTAT 0: 1
1: 1
2: 1
3: 54
4: 526
Right 1126326116 15:47479355-47479377 TGCTAAGTTCAGTAAGAGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 141
1126326112_1126326117 18 Left 1126326112 15:47479333-47479355 CCATCCTCAACCTGTTTCTCTAT 0: 1
1: 1
2: 1
3: 54
4: 526
Right 1126326117 15:47479374-47479396 CAGGCTTGATGCTAAATACTAGG 0: 1
1: 0
2: 3
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126326112 Original CRISPR ATAGAGAAACAGGTTGAGGA TGG (reversed) Intronic
900390079 1:2430004-2430026 ACAGAGAAACAGCTGGAGCATGG + Intronic
900985325 1:6069804-6069826 ACAGGGAAACAAGTTGAGCAGGG + Intronic
901594110 1:10371207-10371229 AGAGAGGGACAGGTGGAGGAGGG - Exonic
901714468 1:11142094-11142116 ATAGAGAGTCAGGTTGGGGACGG + Intronic
901912645 1:12472999-12473021 GTAAAGAAACAGGTTGTGGAAGG + Intronic
902511044 1:16967351-16967373 ATAGAGGGACAGGCTGGGGAGGG - Intronic
902534050 1:17108834-17108856 ATAGTGAGACAGGTTGAAGATGG + Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
904562233 1:31406653-31406675 ATAGAGAAACAGGCCCAGAAAGG + Intergenic
905049384 1:35036688-35036710 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
906105761 1:43291191-43291213 ATAGAGAAACAGGAGGTGGTGGG + Intergenic
906390441 1:45410885-45410907 AAAGACAAACAGCTTGAGGTTGG - Intronic
907616593 1:55932952-55932974 ATAGAGAAATATGTTAAGGCAGG - Intergenic
908916250 1:69129854-69129876 ATAACGAAACAGGGTAAGGAGGG + Intergenic
909018186 1:70402200-70402222 ATAGTGAAATATCTTGAGGATGG + Intergenic
909093585 1:71258086-71258108 ATAGGAAAACAGGGAGAGGAGGG + Intergenic
909139844 1:71849637-71849659 ATAGAGAAATATGTTGTGAAAGG + Intronic
909512674 1:76472610-76472632 ATAGAGGAAAAGATTGAGGCAGG - Intronic
909919223 1:81359760-81359782 TAAGAGAAACAGGTTGGGGGTGG - Intronic
909970962 1:81989173-81989195 ATAGGAAAAGAGGTTTAGGAGGG - Intronic
909974989 1:82035516-82035538 ATAGAGCAAAATGTGGAGGAAGG + Intergenic
911221718 1:95254310-95254332 ATAGAAAAACAGGTCGGGCATGG + Intergenic
911571991 1:99528502-99528524 ATTCACAAACAGGTGGAGGATGG - Intergenic
911697504 1:100907798-100907820 AGAGAGTAAGAGGCTGAGGAAGG - Intronic
911735325 1:101330718-101330740 ATAGAGAACAAGGTAAAGGATGG + Intergenic
912140991 1:106726969-106726991 ATAGTGTAACAGGTTGACTATGG + Intergenic
912278835 1:108290986-108291008 AGAGAGAAATAAGTTGAAGATGG - Intergenic
912289391 1:108403371-108403393 AGAGAGAAATAAGTTGAAGATGG + Intronic
913090528 1:115473750-115473772 AGAGAGAAGCAGGGTAAGGAAGG + Intergenic
913502972 1:119488809-119488831 AGAGAGAGAGAGGTTGAGGGAGG + Intergenic
913511579 1:119567426-119567448 GTAGAGAAACAGGCAGAGCATGG - Intergenic
913515816 1:119604752-119604774 GTAGAGAAACAGGCAGAGCATGG - Intergenic
914924284 1:151871032-151871054 AGAAGGAAACAGGTTGAGCAAGG + Intergenic
915802275 1:158807108-158807130 AGAGAGAATGAGGCTGAGGAGGG + Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
916327395 1:163578301-163578323 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
916666503 1:166972691-166972713 AAAGAGAAACAGGAGGAGAAGGG + Intronic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
917176070 1:172236923-172236945 ATAGAGGAAGAGGAAGAGGAAGG - Intronic
917381445 1:174413662-174413684 ATAGAGAAAGGGGGGGAGGAGGG - Intronic
918203782 1:182291318-182291340 GCAGAAAAACAGGCTGAGGATGG + Intergenic
918526891 1:185474397-185474419 AGAGAAAAACAGGTTGAGATGGG - Intergenic
918531916 1:185532192-185532214 AAAGAGAAAATGGTGGAGGAGGG - Intergenic
918779720 1:188684003-188684025 GAAGAGAAAAAGGTTGAGAATGG + Intergenic
918813761 1:189156085-189156107 ATTGAGAAACAGGTAGTGAAGGG + Intergenic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
920097534 1:203496328-203496350 ACAGAGAAAGAGGTGGAGGCTGG - Intronic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
922677151 1:227560123-227560145 AGAGAGAGACAGGGTGAGGGAGG - Intergenic
923078767 1:230633989-230634011 GGAGAGGAACAGGTAGAGGAGGG + Intergenic
924207112 1:241724980-241725002 ATAGGGAGGCAGGCTGAGGAAGG - Intronic
1063454199 10:6171767-6171789 ATAGATAAACAGGTTGTTGGGGG + Intronic
1063602577 10:7495755-7495777 AGAGAGAAACAGGCTGAGAGAGG + Intergenic
1063644423 10:7865053-7865075 ATAGAGTGATGGGTTGAGGAGGG + Intronic
1063838388 10:10042680-10042702 AGAGAGAAACAACTTGAGAATGG - Intergenic
1065217403 10:23462552-23462574 ATAGATATACTGGTTGAGGCCGG + Intergenic
1065917051 10:30361449-30361471 AGAAAGAAACAGGTGGGGGAGGG - Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067189253 10:44056141-44056163 ACATAGAATCAGGTTGAAGATGG + Intergenic
1067742354 10:48905241-48905263 ATAGAGGGGCAGGTAGAGGAGGG + Intronic
1067764619 10:49075645-49075667 ATAGAGACACAGGCAGAGGCTGG + Intronic
1068577014 10:58695440-58695462 TTAGAGAAACAGGCTGCAGATGG + Intronic
1069596586 10:69675917-69675939 ATAGAACAAAAGGTGGAGGAAGG - Intergenic
1070042894 10:72799218-72799240 AAAAAGAATCAGGTTGAGGCCGG - Intronic
1070444666 10:76485002-76485024 ATACAGAAACAGGTTGAAAATGG - Intronic
1070701271 10:78603359-78603381 ACAGAGACACAGGTTGAAGATGG - Intergenic
1070997648 10:80800037-80800059 ATAGAGCATAAGGTGGAGGAAGG + Intergenic
1071849804 10:89557312-89557334 ATAGAAAAAAAGGCTGAGGTGGG + Intergenic
1073186019 10:101615469-101615491 AATGAGACACAGGCTGAGGAGGG + Intronic
1073623895 10:105076444-105076466 AGAGAGAAACAGGTTTATAAAGG - Intronic
1073961996 10:108942647-108942669 ATTGAGAAAGAGGCTGAAGACGG - Intergenic
1074275001 10:111992744-111992766 AGAGAGAATCAGGTTGGGAAAGG - Intergenic
1074821655 10:117183907-117183929 ATAGACACACATGTTGAAGAGGG + Intergenic
1075015606 10:118908197-118908219 CTAGAGAAACAGGCTGAGTGGGG - Intergenic
1075212138 10:120500417-120500439 ATAGAAAAGCAGGTGGATGAGGG - Intronic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1076360527 10:129885583-129885605 ATAGAGAAATAGGTAAAGGGGGG - Intronic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1076484408 10:130806747-130806769 ATAAAGAAATAGGTCGAGAAGGG - Intergenic
1076939887 10:133597008-133597030 ATAGAGAAACAGCTAGAATATGG - Intergenic
1077345767 11:2051391-2051413 ATAGTGTAACAGGTTGAAGTAGG - Intergenic
1078034829 11:7792730-7792752 ATAGAGCTACAGATTCAGGAAGG - Intergenic
1079239573 11:18713059-18713081 AAAGTGAAACAGGGTGAGGTGGG - Intronic
1079468619 11:20757017-20757039 ATAGAGATAGATGTTGGGGAAGG + Intronic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1079899882 11:26169114-26169136 AGAGAGAGATAGGTTGAGGGAGG - Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080582687 11:33656950-33656972 ATAGAGAAACAGGGGCTGGAGGG - Intronic
1082888828 11:58116655-58116677 ATAGAAAACCAGGTTGACCAAGG - Intronic
1083273798 11:61585841-61585863 ACAGAGAAACAGGCAGAGGTAGG - Intergenic
1083669093 11:64290624-64290646 ATAGAGAATCAGCTTGAAGCTGG + Intergenic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1085021807 11:73214729-73214751 GTAGAGAAACAGGTTCAGAAAGG - Intergenic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1085192990 11:74645200-74645222 AGAAAGAAACAGGCTGAGGTAGG + Intronic
1085646188 11:78224526-78224548 ATAGAGCAAGAGTTAGAGGAAGG - Intronic
1085721883 11:78919640-78919662 AAAGGGAAACAGGGTCAGGAGGG + Intronic
1086370691 11:86152647-86152669 CTAGAGTGACAGGTGGAGGAAGG - Intergenic
1086395442 11:86410726-86410748 AGAAAGGAACAGGTTAAGGAGGG - Intronic
1088030274 11:105240257-105240279 AAAGAGAAACAAGATGAGAAGGG + Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088859241 11:113784412-113784434 TTAGAGAAAGAGTTTGAGGAAGG + Intergenic
1089120457 11:116130844-116130866 AGAGAGAGAGAGGTGGAGGAGGG - Intergenic
1089164448 11:116464323-116464345 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1090418838 11:126559428-126559450 GTAGAGAATCAGCTGGAGGAGGG - Intronic
1090672998 11:128963486-128963508 AAAGAGAAAAAGGAAGAGGAGGG + Intergenic
1090926145 11:131252012-131252034 CAAGAGAAACAGGGTGAGGCAGG - Intergenic
1090968924 11:131622973-131622995 AAAGAGAAAGAGGAAGAGGAAGG + Intronic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1093396214 12:18685804-18685826 AGAGAGATACAGGAGGAGGATGG - Intronic
1093936900 12:25011111-25011133 ATAAAGAAACAGGTTCAGAGAGG + Intergenic
1094146362 12:27232511-27232533 ATAAAGACACAGGGTGAAGACGG - Intergenic
1094801677 12:34044733-34044755 AAAGAGAAACAGGTTGTATATGG - Intergenic
1096613728 12:52819729-52819751 ATAAGAAAACAGGTTGAGGAAGG - Intergenic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1097249217 12:57623196-57623218 GTGGAGAAACAGGTGGAAGATGG + Intronic
1099006173 12:77236994-77237016 ATAGAGAAGCTGGTTGATCATGG - Intergenic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1100892264 12:99138989-99139011 AGAGAGAGAGAGGTTGAGGGAGG - Intronic
1101625810 12:106440174-106440196 ATAGAGAAAAAGGGTCAGGACGG - Intronic
1101931253 12:109015912-109015934 AAAGAGGAGCAGGTGGAGGACGG + Intronic
1102398250 12:112606112-112606134 ATAGAGTCACAGCTTGTGGAAGG - Intronic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1102762229 12:115398045-115398067 ATAGAAAAACAAGTTGAGAGGGG + Intergenic
1103273763 12:119694884-119694906 ATGGAGAAACAGGTTGTGAGAGG - Intronic
1103374548 12:120445746-120445768 AGAGAGAAACAGGCTAACGAAGG + Intronic
1104424171 12:128660880-128660902 CCAGAGAAACAAGATGAGGAGGG + Intronic
1104739653 12:131163631-131163653 ACAGAGAAACAGGGTCAGGCCGG - Intergenic
1105259958 13:18771778-18771800 ATATAGAAGCAGGTTCAGAAGGG - Intergenic
1105700389 13:22931547-22931569 ATAGAACAAAAGGCTGAGGAAGG - Intergenic
1105774349 13:23643624-23643646 ACACAGTAACAGGCTGAGGATGG + Intronic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1108457351 13:50629620-50629642 ATAGAGAGATAGGGTGAGAAGGG - Intronic
1108746012 13:53395077-53395099 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1110837948 13:80106479-80106501 ACAGAGAAACAGATGGATGAAGG - Intergenic
1111022248 13:82467176-82467198 ATAGTGAGAAAGGTTGATGAAGG + Intergenic
1111181005 13:84665049-84665071 AAAGAGAAATAGGAAGAGGAAGG + Intergenic
1111630605 13:90842658-90842680 ACAGAATAACAGGTTGTGGAGGG - Intergenic
1111961274 13:94813267-94813289 ATAAAGAATCAGGTGGTGGAAGG + Intergenic
1112417091 13:99212123-99212145 ATATTGAGACAGGTTGAGAACGG - Intronic
1113447120 13:110377749-110377771 ATAGAAAAACATGTTAAAGAAGG + Intronic
1113654411 13:112058808-112058830 AGAGAGAAAGGGGTTGGGGAAGG + Intergenic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114452141 14:22834339-22834361 ATCCAGAGACAGGGTGAGGAAGG - Exonic
1115150177 14:30275786-30275808 ACAGAGAATCAGGTTCAGGGAGG + Intergenic
1115654253 14:35428109-35428131 ACAGAGAAACAGCTTGAAAATGG + Intergenic
1116444915 14:44997711-44997733 ATTTAGAAAGAGGTTGAGGCCGG + Intronic
1117021350 14:51573988-51574010 ATAAAAAAATAGGTTGAAGAGGG - Intronic
1117313083 14:54547884-54547906 TTAAAGAACCAGGCTGAGGAAGG - Intergenic
1117392835 14:55278975-55278997 ATAAAGAAACAGGGTGGGCATGG - Intronic
1118282581 14:64442895-64442917 ACAGAGAAACAGGTGGAGACTGG + Intronic
1118416408 14:65541570-65541592 TTAAACAAAAAGGTTGAGGATGG - Intronic
1118508521 14:66443851-66443873 AGAGAGAAAGAGTTTGGGGAAGG + Intergenic
1118736562 14:68705395-68705417 ACAGAGAGGCAGGTGGAGGAAGG + Intronic
1118959224 14:70513576-70513598 AGAGAGGAACAGGGTAAGGAAGG + Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119960853 14:78854917-78854939 ATAAAAATACAGGTTGAGTAAGG + Intronic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1120515150 14:85461818-85461840 ATAGAGAAAAAGGATGACTATGG + Intergenic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121656503 14:95600381-95600403 ATCTAGAAATAAGTTGAGGATGG + Intergenic
1121729719 14:96178061-96178083 ACAGAGAAACAGGCAGGGGAGGG + Intergenic
1121896276 14:97650891-97650913 ATAGCTAAAGAGGTTGGGGAAGG + Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123803006 15:23841036-23841058 TTAGAAAAAAAGGCTGAGGATGG - Intergenic
1123902870 15:24893861-24893883 AAAGAGAAAAAGGTGGAGAAAGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126431918 15:48594996-48595018 AAAGAGAAGCAGTTTAAGGAGGG + Intronic
1127194499 15:56569007-56569029 AGAGAGGAACAGGTGGTGGATGG - Intergenic
1128222092 15:65976517-65976539 ATAGAGACACAGGGAGAAGATGG + Intronic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1129595706 15:76962497-76962519 ATGGAGAAACCGGTAGAGGGTGG - Intergenic
1130983664 15:88830286-88830308 ATAAAGAAACGGGCTGGGGAAGG - Intronic
1131563553 15:93464907-93464929 ATAGAACAAAAGGTGGAGGAAGG - Intergenic
1131599741 15:93834752-93834774 ATAGAGAAACGAGTTGTGGGAGG + Intergenic
1131769340 15:95718278-95718300 ATAGAGAAAGAGGATAGGGAAGG - Intergenic
1132148318 15:99441816-99441838 GTAGAGAAAAAGCTTGGGGATGG - Intergenic
1132721358 16:1317775-1317797 ATAGAGAAACAGCTTCCAGATGG + Intronic
1132840318 16:1975658-1975680 GTAGAGCAACAGGTTGTGGTCGG - Exonic
1132949242 16:2551285-2551307 ACAGAAAACCAGGTGGAGGAAGG - Intronic
1132957044 16:2599799-2599821 ATAGGGAAACAAGTGGAGCAGGG + Exonic
1132965346 16:2650843-2650865 ACAGAAAACCAGGTGGAGGAAGG + Intergenic
1132969391 16:2678218-2678240 ATAGGGAAACAAGTGGAGCAGGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133390510 16:5406333-5406355 ATAGAACAAAAGGTGGAGGAGGG + Intergenic
1133844982 16:9445125-9445147 ATTGAGGAACAGGTAGGGGAAGG + Intergenic
1134074825 16:11283279-11283301 ATAGAGAAAGAGGGAGAAGAAGG + Intronic
1134328141 16:13225815-13225837 AGAGAGAGACAGATGGAGGAAGG + Intronic
1134892856 16:17856323-17856345 AGAGGAAAACAGGTTGAGAATGG - Intergenic
1135163704 16:20120176-20120198 AGAGAGAAAGAGGTGGAGGAGGG - Intergenic
1135594328 16:23730106-23730128 AAAGGGAAACAGGGTGAGGCAGG - Intergenic
1135711742 16:24723107-24723129 AGAGAGAAACAGGATGAGTGTGG - Intergenic
1135912773 16:26576726-26576748 ATAGAGCAAAAAGTGGAGGAAGG - Intergenic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1137698290 16:50477557-50477579 TTAGGGAAACATGCTGAGGAGGG - Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138719327 16:59060564-59060586 ACAGACAAAAAGGTGGAGGAAGG + Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1141047998 16:80734542-80734564 ATAGGGAAGCAGGTTTGGGAAGG + Intronic
1141444101 16:84047131-84047153 ATAGAGAAACTGCTTGTGGTCGG + Intergenic
1141968951 16:87466913-87466935 GTAAAGAAACAAGGTGAGGAGGG - Intronic
1142576655 17:913497-913519 AGAGAGCAACAGGCTGAGAAAGG + Intronic
1143276953 17:5718807-5718829 AGTGAGAAAGAGATTGAGGATGG + Intergenic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143588327 17:7863628-7863650 ATTTAGAAACAGTTTCAGGATGG - Intronic
1144006606 17:11106082-11106104 TGAGTGAAACAGGATGAGGAGGG - Intergenic
1144678370 17:17176231-17176253 ATACAGAAACAGGAAGAGGAAGG - Intronic
1146761049 17:35479106-35479128 ATTCAGAACCAGGTTGAGGAAGG - Exonic
1147391420 17:40111660-40111682 TTAGAGAGAAAGGTTGAGGCTGG + Intergenic
1147985335 17:44303772-44303794 AGAGAGAAACGGGCTGGGGACGG - Intergenic
1148670762 17:49408412-49408434 ATAGCGTTTCAGGTTGAGGAGGG - Intronic
1148932217 17:51136400-51136422 ATAGAGAGACAGCTAGAGGGAGG + Intergenic
1149306662 17:55354173-55354195 AGATAGAAACTGGATGAGGAGGG + Intergenic
1151355833 17:73558015-73558037 ATAGAGCAACAGGGTGAGGAGGG - Intronic
1151492644 17:74441917-74441939 ATAGAAAAACAAGTTCTGGAAGG - Intronic
1151536570 17:74742228-74742250 AAAGAGAAAAAGGCAGAGGATGG - Intronic
1151869679 17:76827846-76827868 AAAGAGAAACGGGATGAGCACGG - Intergenic
1152563014 17:81087973-81087995 TCACAGAAACAGCTTGAGGACGG - Intronic
1152675376 17:81637411-81637433 GTAGAGAAACAATTTCAGGAAGG + Intronic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1155924234 18:31637291-31637313 AGAGAGAACCAGGTGGAGAATGG - Intronic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156637113 18:39044775-39044797 ATATAAAAACAAGTTGAGGCCGG - Intergenic
1156779705 18:40836852-40836874 ATAGAGAAAGAGGGAGAGGGAGG + Intergenic
1156899251 18:42281735-42281757 ATACAGAAAGAGGTGGAGGTGGG - Intergenic
1156985776 18:43349948-43349970 AAAGACAAAAAGGTAGAGGAAGG - Intergenic
1158821006 18:61158824-61158846 ATAGAAGAAAAGGTGGAGGAAGG - Intergenic
1158953379 18:62518239-62518261 AAAGAAAAAGAGGTTGGGGAGGG - Intergenic
1159182551 18:64927497-64927519 GTAGATAAAAAGGTTGAGGTTGG + Intergenic
1159513161 18:69422450-69422472 ATAGAGTAGCTGGTTCAGGAGGG - Intronic
1160005913 18:75069062-75069084 GCAGAGAAACAGGCCGAGGATGG + Intergenic
1160172547 18:76566960-76566982 AGAGAGAGACAGGTAGGGGAAGG - Intergenic
1160521128 18:79508758-79508780 ACAGAGAAACAGAGCGAGGAAGG - Intronic
1161737585 19:6001156-6001178 AGAAAGAAACAGGCTGGGGATGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163410919 19:17154109-17154131 ATACATAAACAGCTTGAGGCCGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1165939058 19:39406358-39406380 AGAGATAGACAGGGTGAGGAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166983386 19:46645218-46645240 ATAGAAAAACAGGACGAGCACGG + Intergenic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
925047804 2:787883-787905 GAAGAGAAGCAGGTTGAGGCAGG + Intergenic
925218822 2:2121463-2121485 ACAAAGAAAGAGGTTGAGGGCGG - Intronic
925562675 2:5214677-5214699 TTAGAGACACAGGGTGAGAATGG - Intergenic
925843903 2:8018753-8018775 ATTGAGACACTGCTTGAGGAAGG + Intergenic
925864275 2:8212527-8212549 ATAGAGAAAGAGGGAGAGGAAGG - Intergenic
925887726 2:8407597-8407619 ATAGAGTAAAAGGTGAAGGAAGG + Intergenic
926343393 2:11923480-11923502 ATATAGAAAGGGGTTGAGGCCGG + Intergenic
926412552 2:12619774-12619796 ATCTGGAAAGAGGTTGAGGAAGG - Intergenic
926484287 2:13435761-13435783 TTAGATAAACAAGTAGAGGAAGG - Intergenic
927250563 2:20991901-20991923 CCAGAGAAACAGGGTGAGGAAGG + Intergenic
928079838 2:28301092-28301114 ACAAAGAAACAGGGTGTGGAAGG - Intronic
928520585 2:32084587-32084609 ATAGAAAAAATGGTTGAGGCTGG + Intronic
929651520 2:43684394-43684416 AAAGAGAAAAAAATTGAGGATGG + Intronic
929770490 2:44887742-44887764 ATAGAGAATCATCTTGAGGAAGG - Intergenic
929923815 2:46193153-46193175 ATATAGATACAGGTTTAGAAAGG - Intergenic
929966477 2:46541239-46541261 ACTGAATAACAGGTTGAGGAAGG - Intronic
930610513 2:53537916-53537938 ATAGAGAAATATGAGGAGGAAGG + Intronic
930978431 2:57492904-57492926 ATAGAGGAATAGTGTGAGGAAGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932939480 2:76145778-76145800 ATACAGAGACAGGTATAGGAAGG + Intergenic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933335251 2:80949894-80949916 GTAGGGAAACAGATTGAGAAAGG - Intergenic
933414334 2:81966909-81966931 ACAGAGAAACATTTTGAGAAAGG + Intergenic
934602148 2:95665840-95665862 GTACAGAAACAGGCAGAGGAGGG - Intergenic
934962707 2:98691095-98691117 ATAGAGAAAGAGGGTGGGGTGGG + Intronic
935253666 2:101288587-101288609 TAAGGGAAATAGGTTGAGGAGGG - Intronic
936029792 2:109062096-109062118 GGAGAGAAACAGATTGAGAAGGG - Intergenic
936628254 2:114172193-114172215 ATAGAACAAAGGGTTGAGGAAGG + Intergenic
936752531 2:115662788-115662810 ATTGAATAACAGTTTGAGGAAGG - Intronic
936920505 2:117684056-117684078 ATAAAGGAACAGGATCAGGATGG - Intergenic
937259508 2:120576642-120576664 ACAGAGACACAGGATTAGGAAGG + Intergenic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
938867458 2:135437951-135437973 ATAGAAAAAAAGGTAGAGGAAGG + Intronic
939519368 2:143210289-143210311 TTTGGGAAACAGGCTGAGGAAGG - Intronic
939673684 2:145045401-145045423 TTATTGAAACAGGTGGAGGAGGG - Intergenic
941635410 2:167930492-167930514 ATACAGAAACAGGGCCAGGAAGG + Intergenic
942862259 2:180629085-180629107 GAAGAGAATGAGGTTGAGGATGG - Intergenic
942894749 2:181038910-181038932 ATAAAAAAACAGGATGAGGAAGG + Intronic
942895763 2:181052337-181052359 AGAGAAAAAGAGGATGAGGAAGG - Intronic
942923927 2:181410458-181410480 AGAGAAAGACAGATTGAGGATGG - Intergenic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943850261 2:192711522-192711544 CTAGATAAACAGGTTGAGGGTGG + Intergenic
945057156 2:205879093-205879115 ATAGAATAAAAGGCTGAGGAAGG + Intergenic
945781914 2:214185901-214185923 ATAGAAAAACAAGATGAGTATGG - Intronic
947592671 2:231394455-231394477 AAAGGAAAAAAGGTTGAGGAAGG + Intergenic
948243089 2:236454985-236455007 AAAGAGAAAAAGATGGAGGAGGG - Intronic
948704933 2:239784183-239784205 ATAGAACAAAAGGTGGAGGAAGG - Intronic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1169986697 20:11453014-11453036 AGAGAGAAACAGGAAGAGGTAGG + Intergenic
1170611965 20:17921886-17921908 TTAGAGAAATGGGTTAAGGAGGG + Intergenic
1171451410 20:25238530-25238552 GTAGTGACACAGGCTGAGGAAGG + Intergenic
1171883582 20:30635384-30635406 ATATAGAAGCAGGTTCAGAAGGG - Intergenic
1172355395 20:34276392-34276414 CACGAGAGACAGGTTGAGGAGGG + Intergenic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1173172155 20:40736154-40736176 ATATAGATACAGGTTGGGGTTGG + Intergenic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1173811873 20:45960758-45960780 ATGGAGAAAGAAGTGGAGGAGGG + Intronic
1174462686 20:50694010-50694032 AGAAAGAAACAGGCTGAGCATGG + Intergenic
1174607190 20:51769168-51769190 ATAGAGAATGAGGGTGAGGATGG - Intergenic
1175052190 20:56166138-56166160 AGACAGAAACAGGATAAGGAAGG + Intergenic
1175921383 20:62451972-62451994 AAAGAGAAAGAGGGAGAGGAGGG + Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1177953971 21:27573897-27573919 ATAGAGGAAGAGGTAGAGGTAGG + Intergenic
1177957898 21:27623598-27623620 ATAAAGCAAAAGGTGGAGGAAGG + Intergenic
1177998512 21:28132042-28132064 ATTGAGTAACAGGTAGAGGTTGG - Intergenic
1181368325 22:22397154-22397176 AGAGAGACACAGGGTGAGGGAGG - Intergenic
1181376860 22:22465615-22465637 AGAGAGACACAGGGTGAGGGAGG - Intergenic
1182046184 22:27275897-27275919 AAATAGAGACAGGTTGAGGCAGG + Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182503766 22:30767444-30767466 ATAGAGACAGAGGAAGAGGATGG - Intronic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1184998967 22:48230592-48230614 ATAGAGAAACAGGTGCCAGAGGG + Intergenic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
949585335 3:5431495-5431517 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
950322825 3:12072712-12072734 ATAGAAAAACAGGATGAATATGG - Intronic
950358222 3:12429569-12429591 AAAAAGAAGCAGGTGGAGGAAGG + Intronic
951963930 3:28361049-28361071 ATAAAGATACATCTTGAGGATGG - Intronic
952721935 3:36542558-36542580 AAAGAGAAAAAGGTGTAGGAAGG - Intronic
953118082 3:40012657-40012679 ATAGAGCAAGAGGTAGAGGAAGG + Intronic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
954424448 3:50435987-50436009 TTAGAGACACAGGGTGAGGAGGG + Intronic
955086940 3:55711949-55711971 ATAGAGAAAGAGGTACAGGCTGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956045544 3:65192090-65192112 AAAGAGAAACAGGTTCATAATGG - Intergenic
956221415 3:66907841-66907863 ATAGAGGATAAGGTTGAGCAAGG - Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956687061 3:71839892-71839914 ATAGAGAAACAGGCTTAGAGAGG + Intergenic
958168422 3:89907255-89907277 AGAGAGAGACAGATTGAGAAAGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
958927418 3:100173890-100173912 ACAAAGAAACAGGCTGAGAAGGG - Intronic
959782682 3:110255121-110255143 TTAGAAAAAAAGGTTGAGGGAGG - Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960108650 3:113824131-113824153 ATAGAAAAACAGGCTTAGGCTGG - Intergenic
960814225 3:121657055-121657077 ATAGATAATAGGGTTGAGGAGGG + Intronic
960920668 3:122744561-122744583 ATACAGAAAGATGTTGAAGAAGG + Intronic
962186827 3:133269231-133269253 ATAGAGAAAGAGGGGGAGGGAGG + Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962849952 3:139300975-139300997 AAAGTGAACCAGGTTGGGGAGGG + Intronic
962957720 3:140281516-140281538 ATCCAGAAACACGTAGAGGAAGG + Intronic
963091159 3:141485394-141485416 AAACAGAAACAGGTTTAGGAAGG + Intergenic
964090453 3:152870038-152870060 ATAGGGAAGTAGGTTGAGAAGGG - Intergenic
964192962 3:154026931-154026953 ATAGAGATAAAGGTAGAGGGGGG + Intergenic
964200626 3:154114922-154114944 AAAGAAAAAGAGGTGGAGGAAGG - Intergenic
964886429 3:161488863-161488885 ATAGACAAAGATGTTGTGGATGG + Intergenic
965516238 3:169624468-169624490 ATGGAAAGACAAGTTGAGGATGG + Intronic
965619988 3:170633697-170633719 AGAGAGCAGCAGGTTGAGGGTGG - Intronic
966121298 3:176523925-176523947 AGACAGAAAAAGGCTGAGGAAGG + Intergenic
966285492 3:178290240-178290262 ATAGAGAAAAGGATTGAAGAGGG + Intergenic
966406288 3:179601866-179601888 ATAAAGAAACAGGTTTAGACAGG - Intronic
966714715 3:183003813-183003835 CAAGAGAAACAGGTAGAGGGAGG - Intergenic
967114210 3:186322007-186322029 AGAGAGAAACAAGCCGAGGAAGG - Intronic
968178460 3:196571004-196571026 ATAGAAAAACAACTTGAGGCCGG - Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
969322305 4:6419853-6419875 ACAGAGACACAGGGAGAGGAAGG - Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
971514355 4:27467954-27467976 AAAGAAAAAGAGGATGAGGAAGG - Intergenic
971636811 4:29071668-29071690 ATAAATATCCAGGTTGAGGAAGG - Intergenic
971865661 4:32168258-32168280 GAAGAGAAAGAGGGTGAGGAGGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972784320 4:42312854-42312876 TTAGAGAAACAGGTTAAACACGG - Intergenic
973667368 4:53176651-53176673 AGACAGAAACAGGTTTTGGATGG + Intronic
974355127 4:60802650-60802672 TTAGAAAGACAGGTTGAGGGAGG - Intergenic
974583753 4:63841894-63841916 ATTAAGAAACAAGTGGAGGATGG - Intergenic
975189998 4:71449436-71449458 AAAGAAAATAAGGTTGAGGATGG + Intronic
975318770 4:72985346-72985368 AAAGAAACACAGGTGGAGGATGG - Intergenic
975547623 4:75575837-75575859 ATAATAAAACAGGTTAAGGAGGG + Intergenic
975921965 4:79401915-79401937 AAAGAGAAACAAGGTGAGGAAGG - Intergenic
976499524 4:85771415-85771437 ATAGAACAACAGGCAGAGGAAGG - Intronic
976597596 4:86908630-86908652 AGAGAGAGTAAGGTTGAGGAGGG - Intronic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
976748965 4:88434516-88434538 AAAGAGACACAGGTTGGGGATGG + Intronic
976748973 4:88434563-88434585 AAAGAGACACAGGTTGGGGATGG + Intronic
977052197 4:92142591-92142613 ATAAAAAAAAAGGCTGAGGAAGG + Intergenic
977320823 4:95513674-95513696 AGAGAGAAACAGGTGAAGGAGGG + Intronic
978263929 4:106799436-106799458 AAAGAGAAATAGGGTGAGGGAGG - Intergenic
978508078 4:109482522-109482544 ATAGTGAGATAGTTTGAGGATGG + Intronic
978696201 4:111583594-111583616 AGAGAGAAAGAGAGTGAGGAGGG + Intergenic
979121088 4:116902670-116902692 ATAAAGAAACAGGTTCAACAAGG + Intergenic
979501837 4:121449353-121449375 AAAGACAAACAGGTGGAGAAGGG + Intergenic
979529067 4:121749503-121749525 ATAGAACAAAAGGTAGAGGAGGG + Intergenic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
980094249 4:128473188-128473210 GAAGAGAAACAGATTGAAGATGG + Intergenic
981585955 4:146302601-146302623 AATGAGAAACAAGTTGAGGTGGG + Intronic
981589633 4:146345461-146345483 ATAGAGAGCCAGGTGGAGAATGG - Intronic
981866424 4:149425574-149425596 ATAGAAAAAAAGGTGGAGGAAGG - Intergenic
982312383 4:153999670-153999692 AAATACAAACAGGTGGAGGAAGG - Intergenic
983195282 4:164799552-164799574 ATAGAACAAAAGGTTAAGGAAGG - Intergenic
983375525 4:166922623-166922645 TTAGAGAAACAGCATAAGGAAGG - Intronic
983875449 4:172869761-172869783 AGAGAGAATGAGGTGGAGGAGGG - Intronic
984160870 4:176250591-176250613 ATAAAGAAACAGGTCGAGAGAGG + Intronic
984633428 4:182085073-182085095 ATAAAGAAAGAGGAAGAGGAAGG + Intergenic
985127748 4:186712308-186712330 GTAGAGAAACAGGTAGCTGAGGG + Intronic
985987149 5:3525436-3525458 ATAGAACAAAAGGCTGAGGAGGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986095582 5:4550561-4550583 ACAGAGAAACAGTATTAGGAGGG + Intergenic
986346894 5:6844080-6844102 ATGGAGCAAGAGGTTGAGGAAGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
987748116 5:22004245-22004267 ACAGAAAAACAGCATGAGGAAGG - Intronic
987898859 5:23984537-23984559 ATACAGAAAGTGGTTGAGAAAGG - Intronic
988603303 5:32658849-32658871 AAAAAAAAACAGGTTGAGCATGG - Intergenic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
989452040 5:41597797-41597819 ATAGAGTAAAAGGCAGAGGAAGG - Intergenic
989625207 5:43423230-43423252 ATAGAAAAACAGGCTATGGATGG + Intergenic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990098498 5:52152197-52152219 TGAGAGAAACAGGTGGAGGATGG - Intergenic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
990606593 5:57416839-57416861 AGAGAGAAACATGTTGAAAAGGG + Intergenic
990715369 5:58630595-58630617 ATACAGCAACAGGTTGAATAAGG - Intronic
991341457 5:65615190-65615212 ATAGAGAAATAGGCTGGGCACGG - Intronic
991433562 5:66573280-66573302 AGAGAGAAAGAGGAAGAGGACGG + Intergenic
991645083 5:68793346-68793368 TTAGAAAAAAATGTTGAGGAAGG - Intergenic
992317154 5:75567812-75567834 ACAGAGGAACAGCCTGAGGAAGG + Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
993127160 5:83849786-83849808 ATAGAAAAACAGTTTTATGAAGG + Intergenic
993629815 5:90272298-90272320 ATAGACTAACAGATGGAGGAAGG + Intergenic
993667379 5:90717224-90717246 ATAGAAAAAGAGGTTTGGGAAGG - Intronic
994237249 5:97377204-97377226 ATAGAACAAAAGGTAGAGGAAGG + Intergenic
994935770 5:106251568-106251590 AGAGAAAAACAGATTGGGGAGGG - Intergenic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
996037180 5:118771471-118771493 ATAGAGAAACTGATTGAGTTTGG + Intergenic
996646531 5:125824868-125824890 CTAGGGCAACAGGTTGATGAGGG + Intergenic
996796376 5:127352814-127352836 AAAGAGAAACAGGTTGATTTGGG + Intronic
996932392 5:128905400-128905422 GTAGAGAAAGAGGTTGAGTTGGG + Intronic
996998083 5:129723883-129723905 ATACAGAAACAACTTGAAGAGGG + Intronic
997235307 5:132269072-132269094 ATAAAGAAACAGGTTCAGAGAGG + Intronic
997300219 5:132798208-132798230 GTGCAGAAACAGGTTGAAGAGGG - Intronic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998733278 5:145106033-145106055 ATGGACAAAGAGGTGGAGGAAGG - Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999220569 5:149973428-149973450 AGAGAGAGACAGTTTCAGGAAGG - Intronic
1000111991 5:158117054-158117076 AAAGAGAAAGAGGAAGAGGAAGG - Intergenic
1000367734 5:160506561-160506583 AGAGAGAATCAGGTAGGGGAGGG + Intergenic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1000734461 5:164881770-164881792 AAAGAGGAAGAGGTTGAAGAGGG - Intergenic
1001332051 5:170769329-170769351 GAAGAGAAAGAGGCTGAGGAAGG + Intronic
1002056271 5:176599533-176599555 GGAGAGAAGCAGGTTGGGGAGGG + Exonic
1002255198 5:177953350-177953372 GGAGAGAAGCAGGTAGAGGAGGG - Intergenic
1002482938 5:179515384-179515406 GGAGAGAAGCAGGTAGAGGAGGG + Intergenic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1004677290 6:17855636-17855658 AAAGAAGAACAGGTAGAGGAGGG + Intronic
1005605772 6:27475662-27475684 ATAGAGAAACTGGGGGAGGAGGG + Intergenic
1006674122 6:35749863-35749885 ACAGAGACCCAGGTTGAGGGAGG + Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008048191 6:46873133-46873155 TTAAAGACACAGGGTGAGGAAGG - Intronic
1008108541 6:47467174-47467196 ATAGAGAAAAAGGATAAGAAAGG + Intergenic
1008936339 6:56996604-56996626 AGAAAGAAACAGGTTGAAGGAGG - Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009313701 6:62190403-62190425 ATTTAGAAAAAGGTTCAGGAAGG - Intronic
1009350543 6:62671577-62671599 ATAGAAAAAAAAGTGGAGGAAGG - Intergenic
1009423679 6:63490956-63490978 AAAAAAAAAAAGGTTGAGGAAGG - Intergenic
1009455091 6:63847394-63847416 AAAGAGAAAAAGGGAGAGGAAGG - Intronic
1011532654 6:88340330-88340352 ATACATAAAGAGTTTGAGGAAGG + Intergenic
1011902389 6:92314925-92314947 AGAGAGAAAGAGAGTGAGGAGGG - Intergenic
1012277983 6:97296766-97296788 ATAGAAAAGCAGGTTTAGGCTGG + Intergenic
1013934978 6:115583100-115583122 ATAGAAAAACAGATTAAGGTAGG - Intergenic
1014075264 6:117228183-117228205 ACAGAGAAACAAAGTGAGGAGGG - Intergenic
1014522165 6:122457891-122457913 AGAGAGAGTCAGGTTGTGGAAGG - Intronic
1015351384 6:132224279-132224301 ATAGGGAAACAGGTGGATGTTGG + Intergenic
1015651416 6:135465149-135465171 CTAGAGAAACAACTTGAGGTGGG - Intronic
1015804238 6:137092365-137092387 GGAGAGAAACAGGAGGAGGAAGG - Intergenic
1016422133 6:143896562-143896584 ATAAGGAAACAGGTTCAGCAAGG - Intronic
1016522460 6:144962194-144962216 ATAGGGAAACAGGTTGAGATAGG + Intergenic
1016563483 6:145424260-145424282 ATAGAGAAACAGCTGGATGAGGG + Intergenic
1016761433 6:147741720-147741742 ATGGAAAAACAGGTTGAGTGTGG + Intergenic
1017215614 6:151902384-151902406 AGAGAGAAACAGATCTAGGATGG - Intronic
1018654924 6:166025831-166025853 ACAGAGAACTAGGATGAGGATGG - Intergenic
1019131890 6:169883032-169883054 AGAGAGAACCAGGGTGGGGAAGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020355012 7:7266276-7266298 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1020951208 7:14680068-14680090 ATAGAAAATAAGGCTGAGGATGG + Intronic
1021141483 7:17030827-17030849 ATTGAAAAACTGGTTGAAGAGGG + Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021806478 7:24361884-24361906 GAAGAGAAACTGGATGAGGATGG - Intergenic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1022399659 7:30025120-30025142 TTAGAAAATCAGGTGGAGGATGG + Intronic
1022939669 7:35221700-35221722 ATTGAGTAATTGGTTGAGGAAGG - Intronic
1023528412 7:41129265-41129287 AAAGAGAAAGAGGTTGGGAAAGG - Intergenic
1023634163 7:42193141-42193163 CTAGAGAAACAGCTCAAGGAAGG + Intronic
1024367437 7:48537026-48537048 ATACAGACACAGGTATAGGAAGG - Intronic
1024515061 7:50242386-50242408 AGAGAGAAAGAGGGGGAGGAAGG + Intergenic
1024802763 7:53100122-53100144 TGAGAGAAAAAGGTGGAGGATGG - Intergenic
1024937235 7:54722745-54722767 AGAGAGAAAGAGGGAGAGGAGGG - Intergenic
1025271082 7:57517722-57517744 AGAGAGAAACATGTTAAGCAAGG + Intergenic
1026104136 7:67407740-67407762 TTAGAGAAAGAGCTTCAGGAAGG - Intergenic
1027540908 7:79464060-79464082 ATAGTGAAACATTTTGGGGAGGG - Intergenic
1027795651 7:82690691-82690713 CTAGAGAAAAAGGTGGAGGAAGG - Intergenic
1028073122 7:86477148-86477170 ATAGAGTAACAGCTGGAGGTAGG - Intergenic
1028210182 7:88064273-88064295 GTAAAGATACAGGTTGAGGTTGG + Intronic
1030206502 7:106957141-106957163 AGAGAGAGAGAGGATGAGGAAGG + Intergenic
1030427773 7:109401304-109401326 ATAGATAGACAGGTAGGGGAAGG + Intergenic
1030748413 7:113198397-113198419 ATAGAAAAACAGGATGCTGATGG - Intergenic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031183971 7:118452494-118452516 AAAGGGAAACATGTTTAGGAGGG + Intergenic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032063690 7:128747296-128747318 ATAGAGAAATGGGTAGAAGATGG - Intronic
1032609913 7:133401799-133401821 ATAGATTAAAAGGTTGAAGAAGG - Intronic
1032632299 7:133666989-133667011 AAAGAGAAACAGGGAAAGGAGGG - Intronic
1032661031 7:133983883-133983905 AAAGAGAAACAGGGTGGGTAGGG - Intronic
1033496551 7:141903026-141903048 ATAGAGCAAAAGGTGGAGGAAGG - Intergenic
1034051471 7:147988675-147988697 AGAGAGTAACAAGTTCAGGAAGG - Intronic
1035521927 8:281766-281788 ATAGAGCAAAAGGTGGAGGAAGG + Intergenic
1035928939 8:3760115-3760137 AAAGAGTAACAGGCTGAGAAAGG + Intronic
1037384722 8:18326233-18326255 ATAGAACAAAAGGTGGAGGAAGG - Intergenic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038890186 8:31712908-31712930 ATAGACAGACAGATTGAAGAAGG - Intronic
1038918992 8:32061375-32061397 ATTGAGAAACAGTTTTATGAGGG - Intronic
1038995512 8:32918659-32918681 GTAGAGAAAAAGGTTAAGTAGGG - Intergenic
1039170231 8:34736804-34736826 AGAGAGAAATGTGTTGAGGATGG + Intergenic
1039582770 8:38680582-38680604 ATGGAGAAAGACGTTAAGGAAGG + Intergenic
1041093252 8:54324522-54324544 ATAAACAAACATGTTGAGAATGG + Intergenic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041262783 8:56036299-56036321 ACAGAGCAAAAGGTGGAGGAAGG + Intergenic
1041762758 8:61384705-61384727 GAAGAGAAAGAGGTTTAGGATGG + Intronic
1041780167 8:61569103-61569125 ATACAGGCACAGGTAGAGGATGG + Intronic
1042024387 8:64407266-64407288 ATAGAGCAAAAGGTTGAGATGGG + Intergenic
1042366237 8:67939983-67940005 AGAGAGGCACAGGTTGGGGAGGG - Intergenic
1042472450 8:69206793-69206815 ATAGAGCAAAAGGTGGAGTAAGG + Intergenic
1043706839 8:83360750-83360772 ATAGAACAAAAGGTGGAGGATGG + Intergenic
1043987330 8:86708969-86708991 ATAGAGAAATAGGGTGTGGCTGG + Intronic
1044605979 8:94047790-94047812 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1044888499 8:96806229-96806251 ATAAATAAATAAGTTGAGGAAGG - Intronic
1045818670 8:106308279-106308301 ATAAACAAAAAGGTGGAGGAAGG - Intronic
1045832851 8:106485172-106485194 AGAGATAAACAGGTAGAGCATGG + Intronic
1046511447 8:115209449-115209471 TGAGAGAAACAGCTTGAAGATGG + Intergenic
1048601354 8:135922020-135922042 ACAGAGAAATAGGATGAGGAGGG + Intergenic
1051020460 9:12536149-12536171 ACAGAGAAAGAGGTGGAGTAAGG + Intergenic
1051749567 9:20327078-20327100 GTTGAGAAACAGGTTTAGGGAGG + Intergenic
1051868398 9:21708368-21708390 ATAGAGGAACAAGTTGAGTCAGG - Intergenic
1052109216 9:24559864-24559886 AAAGAGGACCAGGTTTAGGAAGG + Intergenic
1052502764 9:29313325-29313347 GTAGAGAAATATGTTGAGTATGG - Intergenic
1052869581 9:33490975-33490997 AAAGAAAAAAAGGTAGAGGATGG + Intergenic
1056557314 9:87700387-87700409 ATAGAGAAACAAGGAGATGATGG + Intronic
1056650856 9:88460710-88460732 ATAGAACAAAAGGTAGAGGAGGG - Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1057965156 9:99495980-99496002 AGTGTGGAACAGGTTGAGGAAGG - Intergenic
1058135753 9:101305960-101305982 ATAAAGAAAGAGGATGATGAAGG - Intronic
1059105796 9:111510382-111510404 AAAGAGAAACAGGTTGGGTGTGG + Intergenic
1059147597 9:111914903-111914925 GAACAGAAATAGGTTGAGGAAGG + Intronic
1059369906 9:113820851-113820873 AGAGAGAAATAGATTGACGATGG + Intergenic
1059634160 9:116155311-116155333 AGAGAGAGGGAGGTTGAGGAGGG - Intronic
1060015431 9:120082521-120082543 AGAGATAAACAGGATGAGTATGG - Intergenic
1060563461 9:124567883-124567905 AAAGAGAAACAGGCTGGGCACGG + Intronic
1185701178 X:2231545-2231567 AGAGAGAAAAAGGAAGAGGAAGG - Intronic
1186323454 X:8453921-8453943 TTAGAAAAACAGGTTCACGATGG + Intergenic
1186662982 X:11687791-11687813 CTAGAGAATGGGGTTGAGGAGGG + Intergenic
1187786583 X:22894955-22894977 AGAGAGAAAAAGGCTGAGGATGG - Intergenic
1189426075 X:40901290-40901312 ATAGAAATGCAGGTTGAGGCTGG - Intergenic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1189915813 X:45854965-45854987 AGAGAGAAAGAGGGGGAGGAGGG + Intergenic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1191020383 X:55853444-55853466 AAAAAGAAACAGGTTCAGTAAGG + Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1192624829 X:72715682-72715704 AGAGAGCAACAGGTGGGGGATGG - Intergenic
1193247189 X:79243209-79243231 ATAAAGTATCATGTTGAGGATGG + Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1195599394 X:106727811-106727833 AGAGAAAAACAGGGAGAGGAGGG - Intronic
1195821681 X:108951932-108951954 ATACAAAAACAGCTTGAGCAAGG - Intergenic
1196063562 X:111437888-111437910 ATAGAGAAAAAGGTACAAGAAGG - Intergenic
1196642165 X:118074727-118074749 ATAGTGAAACAGTTTGGGGGTGG - Intronic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1197818740 X:130524729-130524751 AGAGAGAAAGAGGAAGAGGAGGG - Intergenic
1198107133 X:133472709-133472731 ATAAAGAAACAGGGTGAGAGTGG + Intergenic
1198460891 X:136862145-136862167 ACAGAGAAACACCTAGAGGAGGG + Intronic
1199493213 X:148424106-148424128 ATAGAACAAAAGGTGGAGGATGG - Intergenic
1199850856 X:151724240-151724262 AGAGAGAAAGAGGTGGAGCAGGG - Intergenic
1199904719 X:152213425-152213447 ATAGAGTTACAGGGTGAGGAGGG + Intronic
1200307780 X:155045989-155046011 ATAGAGGAAAAGGTGGGGGAAGG - Intronic
1201986686 Y:19975945-19975967 ATAGAGACAAAGGGTGAGGTTGG - Intergenic