ID: 1126326255

View in Genome Browser
Species Human (GRCh38)
Location 15:47480647-47480669
Sequence TGGCAGAAGCAGGGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 778
Summary {0: 1, 1: 0, 2: 5, 3: 94, 4: 678}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126326255_1126326260 -9 Left 1126326255 15:47480647-47480669 CCCTCCACACCCTGCTTCTGCCA 0: 1
1: 0
2: 5
3: 94
4: 678
Right 1126326260 15:47480661-47480683 CTTCTGCCACTGAACTGCTAAGG 0: 1
1: 0
2: 1
3: 8
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126326255 Original CRISPR TGGCAGAAGCAGGGTGTGGA GGG (reversed) Intronic
900110988 1:1005606-1005628 GGGCAGAGGCAGGCGGTGGAGGG - Intergenic
900627742 1:3617048-3617070 TGGCGGGAGCAGGGTGTAGAGGG - Intergenic
900627775 1:3617144-3617166 TGGCAGGAGCCGGGGGTGGGAGG - Intergenic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
900756060 1:4435685-4435707 TGGCAAATGCAGGGGGAGGAGGG - Intergenic
900944620 1:5822838-5822860 GGGCAGAAGCATGGTGAGGACGG - Intergenic
900988854 1:6088771-6088793 GGGCAGCAGCAGGGGGTGGGGGG - Intronic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901195226 1:7436557-7436579 TGGGAGGAGCAGGGTGAGGTCGG + Intronic
901195788 1:7439127-7439149 TGGGAGCAGCAGGGCCTGGAGGG - Intronic
901256708 1:7834981-7835003 TGGCAGGAGGAAGGTGAGGAGGG + Intronic
901444856 1:9301939-9301961 TGGCAGAAGCACTGTGTGCAGGG - Intronic
901773227 1:11541642-11541664 TGACAGAGGCAGGGTGAGGAAGG - Intergenic
902056391 1:13603982-13604004 TGGCTGAGGCTGGGTGTGGCAGG + Intronic
902255238 1:15184645-15184667 TGGCAGAAGCAGGAAGTAGGTGG + Intronic
902683329 1:18059038-18059060 TGGAGGAGGCAGGGCGTGGAAGG - Intergenic
902836991 1:19053857-19053879 TGGCAGAAGGGGTGTGTGAAGGG - Intergenic
902838688 1:19062069-19062091 CTGCAGATGCAGGGTGTGGCTGG - Intergenic
902947212 1:19850403-19850425 TGCCTGAGGCAGGGTGGGGAAGG + Intergenic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903418443 1:23200969-23200991 TGGGAGAGGCATGGTGTGGCTGG - Intergenic
903655123 1:24944258-24944280 TGGCTGGAGCAGGGTGAGGGAGG - Intronic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904892797 1:33792102-33792124 TGGCAGAATCAAGGTCTGCATGG + Intronic
904914048 1:33956960-33956982 TGGCTGGAGCATGGTGAGGAAGG - Intronic
905092183 1:35438481-35438503 TGACAGATGCAGGGGTTGGAGGG - Intronic
905277942 1:36831124-36831146 GGACAGCAGCAGGCTGTGGAAGG - Intronic
905280001 1:36842987-36843009 TGGCAGGTGGAGGGGGTGGATGG - Intronic
905291266 1:36923299-36923321 AGGCAGCAGCAGGGGGTAGAGGG + Intronic
905363898 1:37438465-37438487 GGGCAGATGCAGGGAATGGATGG - Intergenic
905385405 1:37600016-37600038 TAGCAGAGCCAGGGTGAGGAAGG + Intergenic
905913718 1:41671101-41671123 TAGGAGAGGCAGGGTGGGGAGGG - Intronic
906065259 1:42975929-42975951 GGGTGGAAGAAGGGTGTGGAAGG + Intergenic
907457642 1:54585699-54585721 TGGTGGCAGCAGGGTGTGGTGGG + Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907601974 1:55781087-55781109 TGGCAGAAGCATTGTGTTCAGGG + Intergenic
907807551 1:57836770-57836792 TGTCAGGAGAAAGGTGTGGAAGG - Intronic
907965907 1:59329607-59329629 TGACAGAAGGAAGGTGTGGCTGG - Intronic
908178282 1:61578358-61578380 TGACAGAAGTAGGCTTTGGAAGG - Intergenic
908642786 1:66243804-66243826 TGGCAGAGGCAGGGAGAAGAAGG + Intronic
909548254 1:76870078-76870100 TGGCAGGAGCAGGGGTTGGGGGG + Intronic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
909668258 1:78159839-78159861 TGACAGAAGTAGGGTTTAGAAGG + Intergenic
909781368 1:79551420-79551442 TGGCAGAAGCATTGTATGCAAGG - Intergenic
910282915 1:85521339-85521361 GGTAAGAATCAGGGTGTGGAGGG - Intronic
910709538 1:90165492-90165514 TTTCAGAAGCAGGTTGGGGATGG + Intergenic
911240861 1:95464513-95464535 TGGCGGCAGCGGGGTGGGGATGG - Intergenic
911279079 1:95900668-95900690 TGCCTGCAGCAGGGTGGGGAAGG + Intergenic
912024448 1:105149905-105149927 AAGCAGAAGCAGGGTTTGAAAGG + Intergenic
912625615 1:111203198-111203220 GGGAAGGAGCAGGGTGTGGCAGG + Intronic
912647171 1:111404308-111404330 TGGCAGAAGCATGATGTTGTAGG - Intergenic
912949549 1:114111393-114111415 TGGCACAGCCAGGATGTGGACGG + Intronic
913328782 1:117650365-117650387 TGGCAGGGGCAGGGGGTGGATGG + Intergenic
913608725 1:120490351-120490373 TGCCATAATGAGGGTGTGGAGGG + Intergenic
913986705 1:143572328-143572350 TGCCACAATGAGGGTGTGGAGGG - Intergenic
914205111 1:145520103-145520125 TGCCATAATGAGGGTGTGGAGGG - Intergenic
914207098 1:145541654-145541676 GGTAAGAATCAGGGTGTGGAGGG + Intergenic
914340029 1:146752562-146752584 AGGCAGCAGCAGGGTGTTGTAGG - Intergenic
914447903 1:147765660-147765682 AGGCAGGAGCAGATTGTGGAGGG + Intronic
914582471 1:149031487-149031509 TGCCATAATGAGGGTGTGGAGGG - Intronic
914704129 1:150157615-150157637 TGGCAGAGGCATTGGGTGGAAGG - Intronic
917156600 1:172006618-172006640 AGACAGAAGAAGGGGGTGGAGGG - Intronic
917295561 1:173515641-173515663 TGACAGAAGTAGGCTTTGGAAGG - Intronic
917527028 1:175797161-175797183 TGTCAGGAGCAGGGTGTGTTTGG - Intergenic
917738250 1:177939536-177939558 TGGCAGGAGCTGGGTGGAGAAGG + Intronic
918346299 1:183610197-183610219 GGGCAGGAGCAGGGTGTGGCTGG + Intergenic
918589486 1:186224214-186224236 TGCCTGAGGCAGGGTGGGGAAGG - Intergenic
919791093 1:201291480-201291502 AGGCAGGTGCAGGGTGTGGCGGG + Intronic
919928038 1:202202813-202202835 TGGCAGAAGCAGAGGGTGAGAGG - Intronic
920071230 1:203304707-203304729 TGGGGGAAGGAGGGAGTGGACGG + Intergenic
920266311 1:204726048-204726070 TGGGAGAAGAGGGCTGTGGAGGG + Intergenic
920713108 1:208314063-208314085 TGGCAGAAGGAGGGTGGTGATGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921077025 1:211707906-211707928 TGGCTGTGGCAGGGTGGGGAAGG - Intergenic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
922412698 1:225391552-225391574 GGGCAGAAGCAGGGAGTAGGGGG + Intronic
922564583 1:226593408-226593430 TGGGAGGAGAAGGGTGAGGATGG - Intronic
922889067 1:229046560-229046582 TGGCCGACGCAGGGCGTGGAAGG - Intergenic
922903021 1:229152263-229152285 AGGCAGCAGCAGGGTTTGAAAGG - Intergenic
922927330 1:229360835-229360857 TGGCGGGAGCAGGGTGGGGAGGG + Intergenic
923081267 1:230658048-230658070 TGACAGAAGCAGGCTTTGGAAGG - Intronic
923346285 1:233055852-233055874 GGGCAAAATCAGGGTGCGGAAGG + Intronic
923570169 1:235106520-235106542 TGGGAAAAGCAGGGTATAGACGG + Intergenic
924522487 1:244817031-244817053 TGCCTGAGGCAGGGTGGGGAAGG - Intergenic
1062853945 10:769925-769947 TGGCAGAATCAGTGTCTGGTGGG - Intergenic
1062941707 10:1426803-1426825 AGGGAGAAGCAGGGTATAGAAGG - Intronic
1063162987 10:3433355-3433377 TGGCAGAAGCAGGGAGGAAACGG + Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063343648 10:5292283-5292305 TGGCAGATTCAGGGTCTGGCGGG + Intergenic
1063442942 10:6088531-6088553 TGACAGAAGCAGGGAGGGAAAGG - Intergenic
1064334353 10:14425315-14425337 GGGCAAAAGCTGGGGGTGGAGGG - Intronic
1064457086 10:15497829-15497851 TTGGAGAAGGAGGGAGTGGATGG + Intergenic
1065416426 10:25492260-25492282 TGGCAGAGGCAGGGCCTGGTGGG - Intronic
1065607157 10:27429609-27429631 TGCCAGAAGTATGGTGTGTAGGG - Intergenic
1065875062 10:29990512-29990534 GTGCAGAAGCAAGGGGTGGAGGG - Intergenic
1066429156 10:35336269-35336291 AGGCAGAGGCCGGGTGGGGAAGG + Intronic
1067190568 10:44064508-44064530 TGCCAGGAGCAGGGAGGGGAGGG - Intergenic
1067271649 10:44796756-44796778 TGGCTGAAGCAAAGTGTGCAAGG - Intergenic
1067450553 10:46379607-46379629 TGGAAGGAGCTGGGTGTGGCTGG + Intronic
1067509511 10:46883435-46883457 AGGCAGAATCAGGGAGAGGAAGG - Intergenic
1067586690 10:47480144-47480166 TGGAAGGAGCTGGGTGTGGCTGG - Intronic
1067652743 10:48168420-48168442 AGGCAGAATCAGGGAGAGGAAGG + Intronic
1067927609 10:50526265-50526287 TGGCAGCAGGAGGGGGTGGTCGG + Intronic
1068827398 10:61454760-61454782 TGGCAGATGAATGCTGTGGAAGG + Intergenic
1069184888 10:65410255-65410277 TGGTAGAAGCATTGTGTGCAGGG - Intergenic
1069723305 10:70562796-70562818 TGGAAGGAGCAGGGTGGGCAGGG + Intronic
1069936250 10:71919252-71919274 TGCCTGCAGCAGGGTGGGGAAGG + Intergenic
1069959764 10:72072814-72072836 AGTCAGAATGAGGGTGTGGAGGG + Intronic
1069964774 10:72105340-72105362 TGGCAGAAGCAGGCTCTGTGTGG - Intronic
1070289105 10:75103391-75103413 AGGCAGAAGCAGTGTGTCCAGGG + Intronic
1070360947 10:75688620-75688642 AAGCAGAAGCAGGGTTTGGGAGG + Intronic
1070390692 10:75967942-75967964 AGGCAGTAGTAGGGAGTGGAAGG - Intronic
1070706045 10:78639531-78639553 TGGCAGAAGCACTGAGTGCAGGG + Intergenic
1070818372 10:79339634-79339656 TGGAGGAAGAAGGGAGTGGAGGG - Intergenic
1070918897 10:80171813-80171835 TGGCAGTGGCAGGATCTGGATGG + Intronic
1071237059 10:83661469-83661491 TGGAGGAAGCAGGGTGAGAAAGG - Intergenic
1071493761 10:86153987-86154009 TGGCACAAGCATGGACTGGACGG + Intronic
1071571609 10:86700344-86700366 TGGTTGCAGCAGGGTGTGGAAGG - Intronic
1072205097 10:93196686-93196708 TTGCAGCAGCATCGTGTGGACGG - Intergenic
1072981361 10:100100513-100100535 TGACTGAAGCAGTGTGTGGTGGG - Intergenic
1073283989 10:102376230-102376252 GGGCAGAGTCAGGGTGGGGATGG - Intronic
1073290863 10:102412623-102412645 AGGCAGAAGGAGGGTCTGGATGG - Intronic
1073448079 10:103592820-103592842 TGTGAGGAGCAGGGTGTGGTGGG + Intergenic
1073461181 10:103666874-103666896 TGCCAGGAGAAGGGTGGGGAAGG + Intronic
1074233580 10:111562099-111562121 GGGCAAAAGCAGGCTGGGGAAGG + Intergenic
1074363792 10:112842282-112842304 TGGGGGAAGCAGGGTGGGGCAGG - Intergenic
1074616982 10:115079359-115079381 TGGGAGAAGCAGGTTTGGGAGGG - Intergenic
1074746180 10:116534837-116534859 GGGTAGAAGGAGGGTGAGGATGG - Intergenic
1074948839 10:118308531-118308553 TAGCAGAAGAAGGGGTTGGAGGG - Exonic
1075265430 10:120996812-120996834 AGGCAGACGCTGGGTGTGCAAGG - Intergenic
1075344592 10:121672990-121673012 TGACAGAAGCTGGGCGTTGAAGG + Intergenic
1076136552 10:128049200-128049222 TGGAAGGAGCAGGGGCTGGAGGG + Intronic
1076693686 10:132236876-132236898 GGGCACAAGCAGGGAGTGCAGGG - Intronic
1077170002 11:1161837-1161859 GGGCAGAGGCAGGGGGTGCAGGG + Intronic
1077290023 11:1784812-1784834 TGGGAGAAGCGGGGTTGGGAAGG - Intergenic
1077375116 11:2202153-2202175 TGGCATGAGCTGGGTTTGGAGGG - Intergenic
1078406650 11:11075654-11075676 TGGGAGAGGGAGGGTGTGGGTGG + Intergenic
1078485913 11:11723076-11723098 TGGCAGCAGCAGGGTATACAGGG - Intergenic
1078753688 11:14188653-14188675 TGGCAACAGCATGATGTGGAGGG + Intronic
1078865249 11:15291255-15291277 TGGCAGCAGGAGGGTGAGCAGGG + Intergenic
1079249827 11:18779277-18779299 AGTCAGAAGCAGGGCCTGGAGGG + Intronic
1080615297 11:33940465-33940487 GGGCTGAAGCAGGGTGGGGTTGG - Intergenic
1080635646 11:34121030-34121052 GGGCTGAAGCAGGGTGAGTAGGG + Intronic
1080820270 11:35799211-35799233 TGGCAGAACCTGTGTGGGGATGG - Intronic
1080922187 11:36720266-36720288 TGCCAGTAGCAGGTTCTGGAAGG - Intergenic
1081065303 11:38533642-38533664 TGGCAGGAGCATTGTGTGCAGGG + Intergenic
1081570212 11:44286127-44286149 TGACACAAGCAGTGTGTGCAGGG - Intronic
1081591134 11:44423927-44423949 TGGCAGAAGCATGGTGAGTGAGG - Intergenic
1081659551 11:44879638-44879660 TGGCTGGAACAGGGTGAGGAGGG + Intronic
1082182374 11:49135133-49135155 TGGCAGAAGCTGGGCTGGGATGG - Intergenic
1082999814 11:59280972-59280994 TGGCAGAAGCATTGTGTGCAAGG - Intergenic
1083282530 11:61635972-61635994 TGGCAGGAGGAGGGTGTGCTGGG + Intergenic
1083804723 11:65066945-65066967 TGGCTGAAGCAGGAGGTGGGAGG - Intronic
1084179237 11:67438315-67438337 TGGCAGAAGCTGAGTGGGAAGGG + Exonic
1085128233 11:74016563-74016585 GGGCAGGGGCGGGGTGTGGAAGG + Intronic
1085448342 11:76615904-76615926 GGGCTGAAGCAGGGTGGGGATGG + Intergenic
1085724950 11:78947021-78947043 AGGCAGAAGCAGGGTTTGAGAGG + Intronic
1086346451 11:85902163-85902185 TGGCAGAAGCAGGTGGGGGTGGG + Intronic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1089640433 11:119844246-119844268 GGGCAGGGGCAGGGGGTGGAGGG - Intergenic
1089696395 11:120218738-120218760 GGCTGGAAGCAGGGTGTGGAGGG + Intronic
1090135905 11:124199078-124199100 TGGCAGAAGCAGGCTGTGTGTGG - Intergenic
1090223846 11:125056507-125056529 TGGCACTGGCTGGGTGTGGAGGG + Intergenic
1090418147 11:126555159-126555181 TGGCAGAAGCAGGCTCTGTGCGG - Intronic
1090724974 11:129517071-129517093 TGACAGAAGTAGGCTTTGGAAGG - Intergenic
1090753863 11:129771514-129771536 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1091022099 11:132109420-132109442 TGGCAGATTCAGGGTCTGGTTGG - Intronic
1091103620 11:132898317-132898339 TGGCAGAAGCATTGCATGGAGGG - Intronic
1091104114 11:132902408-132902430 TGGCACATGCTGGGTGTGCACGG + Intronic
1091212566 11:133874635-133874657 TGGCAGAAGCATTGAGTGCAGGG - Intergenic
1091387739 12:105322-105344 TGGCAGGGGCAGGGTGGGGGCGG + Intronic
1091431605 12:440104-440126 TGGCAGCAGCCAGTTGTGGAGGG + Intronic
1091560077 12:1605531-1605553 TGGGAAAAGCGGGGTGTGGCCGG + Intronic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092101184 12:5884959-5884981 TGGTAGAATCAGGCAGTGGATGG - Intronic
1092272544 12:7034794-7034816 TGGCAGAAGCTGTGTATGTAAGG - Intronic
1092922396 12:13244421-13244443 TGGCAGAAGCACTGTGTGCAGGG + Intergenic
1094100213 12:26753549-26753571 TGCCTGAAGCAGGGTGGGGAAGG - Intronic
1096466276 12:51848907-51848929 GGGAAGAAGCCGGGGGTGGAGGG - Intergenic
1097691726 12:62740249-62740271 TGACAGTAGCTGGGTGTAGAGGG - Intronic
1097753699 12:63385863-63385885 TGGCAGAAGCATTGTATGCAGGG + Intergenic
1097904553 12:64906309-64906331 AGGCAGCAGCAGGTTTTGGAGGG + Intergenic
1098450208 12:70610406-70610428 GGGGAGACGCTGGGTGTGGAGGG - Intronic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101086644 12:101243007-101243029 GGGAAAAAGCAGGGGGTGGAGGG + Intergenic
1101194097 12:102365063-102365085 TGGCAGAAGCAAGGTGGGGGAGG - Intergenic
1101646962 12:106640254-106640276 TGGCAGAGGCAGGAAGTGGCTGG + Intronic
1102038116 12:109783521-109783543 GGGCCAAAGCAGGGTGTGGGGGG + Exonic
1102199517 12:111047750-111047772 TGCCAGCTGCTGGGTGTGGAAGG + Intronic
1103338890 12:120210725-120210747 TGGCAGAAGCCGAGTGTGCTGGG - Exonic
1103931955 12:124455490-124455512 AGGCAGAAGCAGGGAGGAGATGG - Intronic
1104038416 12:125114327-125114349 TGGGAGAAGCAGACTTTGGAGGG - Intronic
1104443061 12:128810955-128810977 GGGCAGTGGCAGGGAGTGGAGGG - Intronic
1104644484 12:130487085-130487107 TGGCAAAAGCACAGTGAGGAAGG - Intronic
1105399180 13:20072677-20072699 TGGGGGTGGCAGGGTGTGGATGG + Intronic
1106049188 13:26174824-26174846 TCCCAGAAGCACGGTGTGGAGGG - Intronic
1106755726 13:32821248-32821270 TGGCCGGAGCAGGGCGTGGTGGG + Intergenic
1109933174 13:69244092-69244114 TGGCAGAAGCATTGTGTGCAAGG + Intergenic
1110167389 13:72460092-72460114 GGGCAGACCCAGGGTGAGGAGGG + Intergenic
1110248337 13:73353310-73353332 TGGCAGAAGCATTGTGTACAGGG + Intergenic
1110404105 13:75129520-75129542 TGGCAGGAGCAGGGAGTTTATGG + Intergenic
1111233782 13:85380891-85380913 AAGCAGCAGCAGGGTTTGGAAGG + Intergenic
1111682588 13:91461803-91461825 AGGCAGAAGAAGGGTGTTGGTGG + Intronic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112759458 13:102677529-102677551 TGGCAGAAGCAGAGTTTGTATGG - Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113596439 13:111537375-111537397 TTGCAGAGGCAGGGTCTGGAAGG + Intergenic
1114264477 14:21064795-21064817 TGGAGGAAGCATGGTTTGGAGGG - Intronic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1115023219 14:28708418-28708440 TTGCAGAAGAAGCATGTGGATGG + Intergenic
1115057004 14:29140746-29140768 TGGCATAGGCACGGTATGGATGG + Intergenic
1115130202 14:30045639-30045661 TGCCTGAGGCAGGGTGGGGAAGG - Intronic
1115829933 14:37326421-37326443 TGGCAGAAGCATTGTGTGTAGGG + Intronic
1115834551 14:37385175-37385197 TGGAAGAGGGAGGGTGTGTAAGG + Intronic
1117168733 14:53068078-53068100 TGGCAGAATTAGAATGTGGATGG - Intronic
1117360407 14:54967336-54967358 TAGCAACAGCAGGGCGTGGAAGG + Exonic
1117555241 14:56877035-56877057 TGGGAGATGCAGGGGGTGGAAGG + Intergenic
1118323087 14:64764730-64764752 TGGCAGAAGCAGGCGGGGGCAGG + Intronic
1118713907 14:68545783-68545805 GGGCAGAAGAAGGGAGTGGTGGG + Intronic
1118757191 14:68853615-68853637 TGGCAGATGCAGTGTGATGAAGG - Intergenic
1118946150 14:70389296-70389318 TGGGAGAAGGAAAGTGTGGAAGG - Intronic
1119592540 14:75903424-75903446 GGGCATGAGCAGGGAGTGGAAGG + Intronic
1119891520 14:78186032-78186054 TGGCAGAATCAGGGACAGGAAGG + Intergenic
1120093222 14:80358270-80358292 TGGCAGAAGGTGCGTGAGGAAGG + Intronic
1121307828 14:92917986-92918008 TGGGAGAAGATGGGTGGGGAGGG - Intergenic
1121455859 14:94038578-94038600 TGGCAGAAGTAGGGGGTAGGGGG - Intronic
1121885402 14:97538463-97538485 TGGCAGAGGCGGGCTGTGGAGGG - Intergenic
1122102934 14:99427981-99428003 TGGCAGAGGCAGGGAAAGGAGGG + Intronic
1122389240 14:101369018-101369040 TGGCAGAGGCAGCATCTGGAGGG + Intergenic
1122556589 14:102583922-102583944 AGGCAGGTGCAGGGTGTGAAGGG + Intergenic
1122757939 14:103997455-103997477 TGGAAGGAGCAGGGTGGGGCAGG + Intronic
1122811698 14:104292444-104292466 TGGCAGAAGTAAGGTGGGGGGGG - Intergenic
1122915235 14:104855332-104855354 TGAAAGGAGCAGGGAGTGGAGGG + Intergenic
1124004560 15:25785579-25785601 AGGCAGAAGCAGTGAGTGGCAGG + Intronic
1124040181 15:26094768-26094790 TGCCTGCAGCAGGGTGGGGAAGG + Intergenic
1124055524 15:26237984-26238006 TGGCAGAAGCAGGAGGTGAGTGG + Intergenic
1124647521 15:31449389-31449411 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1124956836 15:34365747-34365769 TGGAAGAAGGATGCTGTGGAGGG - Intronic
1125491501 15:40152062-40152084 TGGCGGAGGAAGGGTCTGGAAGG - Intergenic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1127708592 15:61572327-61572349 TGGAAAAAGCAGTGTGTAGAGGG - Intergenic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128111505 15:65079118-65079140 TGGCAAAAACAGGGTGGGCAAGG - Intergenic
1128128103 15:65207641-65207663 TGGCTGAAGCAGGGAGGGGCTGG - Intronic
1128248988 15:66151861-66151883 GGGCAGCAGCCGGGTGGGGAGGG - Intronic
1128335109 15:66780684-66780706 AGGCAGGGGCAGGGTGTGCATGG + Intronic
1128731763 15:70026065-70026087 GGGCAAAAGCAAGCTGTGGATGG + Intergenic
1129305473 15:74657983-74658005 TGTCAGAGACAGGGTGTGGCTGG - Intronic
1129570869 15:76682424-76682446 TTGCAGTGGCAGGGTGTTGATGG - Intronic
1129893170 15:79085328-79085350 TGGCCTAAGCAGGATGAGGAAGG + Intronic
1130222262 15:82029552-82029574 TGGCTGAAGCAGGGTTTGACTGG - Intergenic
1130726287 15:86442920-86442942 GGGCAGGAGCAGGGGGTGGGAGG - Intronic
1130863429 15:87910797-87910819 TGGCAGTTGCAGGGGGTGCAGGG + Intronic
1131373569 15:91904636-91904658 TGGCAGAGGCAGGTCGGGGAAGG + Intronic
1131399105 15:92110437-92110459 TGGCATGAGAAGGGTTTGGAGGG - Intronic
1131640061 15:94283058-94283080 AGGCAGAAGAAGGCTGTGGGTGG + Intronic
1132119018 15:99160210-99160232 TGACAGAAGGCGGGGGTGGAGGG + Intronic
1132564500 16:615256-615278 AGGCAGAAGGACGGTGTGGGTGG + Intronic
1132609093 16:806172-806194 GGGCAGAAGCAGGGGAGGGAGGG + Intronic
1133252207 16:4490279-4490301 TGACTGAAGCAGGGTATGGGAGG + Intronic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133366613 16:5215374-5215396 TAGAAGACGCAGGGTGAGGAAGG - Intergenic
1133676271 16:8075838-8075860 TGGCAGAAGCAGAGGGTGTGGGG - Intergenic
1133719140 16:8478189-8478211 TGGGAGGAGCAGGTTTTGGAAGG - Intergenic
1134540599 16:15061666-15061688 TGGCACAAGCTGGGTGCTGAGGG + Exonic
1135061483 16:19274863-19274885 TGTCAGAAGCATTGCGTGGAAGG + Intergenic
1135965312 16:27030391-27030413 AGGCAGAAGCAGGGGCTGGAAGG + Intergenic
1135968189 16:27052747-27052769 GGACAGAAGCAGGATTTGGAGGG - Intergenic
1135994798 16:27239848-27239870 TGGAAGAGGCAGGGTGTGTCTGG + Intronic
1136147117 16:28322199-28322221 TGGGAGGACCAGGGTGTGGTGGG - Exonic
1136685236 16:31990162-31990184 TGGCAGGAGCAGGGAGGGGCTGG + Intergenic
1136785849 16:32933697-32933719 TGGCAGGAGCAGGGAGGGGCTGG + Intergenic
1136883922 16:33920107-33920129 TGGCAGGAGCAGGGAGGGGCTGG - Intergenic
1137553511 16:49456049-49456071 TGTCAGAAGCAGGGTGCTGATGG - Intergenic
1137565421 16:49529795-49529817 GGGCTGCAGCGGGGTGTGGACGG + Intronic
1137652593 16:50133374-50133396 TGGTAGAAGCATTGTGTGCAGGG + Intergenic
1137698431 16:50478494-50478516 GGGCAGAGACAGGGTGGGGAAGG + Intergenic
1138027267 16:53531764-53531786 TGGCAGATGCAGGAGGAGGAAGG - Intergenic
1138487804 16:57358000-57358022 TGGCTGCTGCAGGGTGGGGATGG + Intergenic
1138490954 16:57376425-57376447 TGGCTGAATCAGGAAGTGGATGG + Intronic
1138586249 16:57972167-57972189 GGGCAGAAGCATGTTGTGGAGGG + Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1139953130 16:70681454-70681476 GGGCAGAGGCACAGTGTGGAGGG + Intronic
1139994259 16:70964846-70964868 AGGCAGCAGCAGGGTGTTGTAGG + Exonic
1140045228 16:71436262-71436284 GGGCAGCACCTGGGTGTGGAAGG - Intergenic
1140267481 16:73433256-73433278 TGGGAGAACAAGGGGGTGGAGGG - Intergenic
1141849891 16:86637950-86637972 TAGCAGAATCTGGGGGTGGAAGG + Intergenic
1141919861 16:87128448-87128470 TTGGTGAAGCAGGGTGTGGAAGG - Intronic
1141926995 16:87176541-87176563 TGGAAGAAGCCAGGTGTGAAAGG - Intronic
1142291456 16:89195293-89195315 GGGCAGAACCTGAGTGTGGATGG + Exonic
1142335057 16:89483118-89483140 AGGCAAATGGAGGGTGTGGAAGG - Intronic
1203088086 16_KI270728v1_random:1195359-1195381 TGGCAGGAGCAGGGAGGGGCTGG + Intergenic
1142808779 17:2385670-2385692 CGGGAGAAGCAGGGTGTTGAGGG + Exonic
1142978009 17:3656641-3656663 TGGGAGAAGCTGGGTGGTGAGGG - Intronic
1143092555 17:4457663-4457685 TGGCAGAAGCAGGGCTGGCAGGG - Intronic
1143217078 17:5233208-5233230 GGGCTGAAGCGGGGTGGGGATGG - Intronic
1143238002 17:5419715-5419737 TGGCCGAAACAGTGAGTGGACGG - Exonic
1143729078 17:8870166-8870188 TGGCAGAAGGAGGAGGAGGAAGG - Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143890570 17:10099207-10099229 GGGCAGAGGGAGGGTTTGGATGG - Intronic
1144084738 17:11798604-11798626 TGTAAGAAGCAGGGTAGGGATGG - Intronic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1144404938 17:14943010-14943032 TGGCAGAAGGAGGGTGTCATTGG + Intergenic
1144426413 17:15146595-15146617 TGCCTGCAGCAGGGTGGGGAAGG - Intergenic
1144587031 17:16493038-16493060 TGGCAGAGGCACGGGGAGGAAGG - Intergenic
1144785164 17:17827402-17827424 TGGAGGCAGCAGGGTGAGGATGG + Intronic
1144888175 17:18477877-18477899 GGGCAGAGGCAGGGTGCTGAGGG + Intronic
1145144031 17:20466426-20466448 GGGCAGAGGCAGGGTGCTGAGGG - Intronic
1145301907 17:21646693-21646715 TGGCAGCAGCATGGTGTCCAGGG + Intergenic
1145982612 17:29022384-29022406 TGACAGAAGCTGGGTGTTGACGG + Intronic
1146445188 17:32927806-32927828 TGGCAGAGGCAGGGTTTCAATGG + Intergenic
1147146181 17:38485843-38485865 TGGCAGGAGCAGGGAGGGGCTGG + Intronic
1147162056 17:38574056-38574078 TGGGGGAAGCAGGGTGTGTAAGG + Intronic
1147239292 17:39080030-39080052 TGACAGAAGGAGAGTGTGGCTGG - Intronic
1147359289 17:39921163-39921185 TGGGAGATGCAGGGTCAGGAGGG + Intronic
1147584694 17:41647587-41647609 TGGATGAGGCAGGGTGAGGAAGG + Intergenic
1148383953 17:47221346-47221368 TGGCAGCAGCAGGATGTGAGGGG - Intronic
1148863970 17:50619045-50619067 GGGCAGGAGAAGGGTGTGGAGGG + Intronic
1148905870 17:50911798-50911820 AGGCAGAAGCTCGGTGGGGAGGG + Intergenic
1149363034 17:55913916-55913938 TGGCAGAGGCAGGGTGGTGGGGG + Intergenic
1149481825 17:57009685-57009707 TGGCAGAAGCATTGTGGGAAAGG - Intergenic
1149639031 17:58191398-58191420 TGGGAGGAGGAGGCTGTGGAAGG + Intergenic
1149641847 17:58207926-58207948 TGGCAGAGGTACCGTGTGGAAGG - Exonic
1149850372 17:60030346-60030368 TGACCAAAGCAGGGTGGGGAGGG + Intergenic
1149859794 17:60116178-60116200 TGACCAAAGCAGGGTGGGGAGGG - Intergenic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1152689231 17:81710422-81710444 TGGGGGAAGCAGGGCCTGGAGGG - Intergenic
1152785666 17:82246701-82246723 TGGCCGTGGCTGGGTGTGGATGG - Intronic
1152936986 17:83144888-83144910 TCACAGAAGCTGGGTGTGGACGG - Intergenic
1153527944 18:6015353-6015375 TTGCAGAAGGTGGGGGTGGATGG + Intronic
1153919779 18:9778258-9778280 TGGCAGGAGCCGTGTGTGCATGG + Intronic
1155096433 18:22560096-22560118 TGGGGGCAGCAGGGAGTGGAAGG + Intergenic
1155760565 18:29560036-29560058 AGACAGAGGCAGGGTATGGAGGG + Intergenic
1156180437 18:34597460-34597482 TGGCAGGGTGAGGGTGTGGATGG - Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157859970 18:51132765-51132787 TGGCAGCATCTGGGTGTGGCTGG + Intergenic
1158621743 18:59038617-59038639 GAGGAGAAGCAGGGTCTGGAGGG + Intergenic
1158757772 18:60347492-60347514 TGGCAGAAAGAAGGTGGGGATGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160695974 19:484728-484750 TGGCTGCCGCAGGGTGAGGAGGG + Intergenic
1160751762 19:737766-737788 TGGCTGGAGCAGCGTGAGGAGGG + Intronic
1160857045 19:1222332-1222354 TCCCAGCAGCAGGGTGTGGCTGG + Intronic
1160988422 19:1850863-1850885 TGGCTGGACCAGGGTGAGGAGGG + Intergenic
1161208177 19:3053209-3053231 TGGGAGGAGCAGGGTGAGGGTGG - Exonic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161352814 19:3803381-3803403 TGGCAGGGGCTGGGTGTGCAGGG - Intergenic
1161352826 19:3803415-3803437 AGGCAGATGCAGGGTGGGGGCGG - Intergenic
1161352834 19:3803438-3803460 AGGCAGATGCAGGGTGGGGGAGG - Intergenic
1161427280 19:4210476-4210498 TGGCTGCAGCAGGGTGGGGAGGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161803032 19:6426254-6426276 TGGCAAAAGCAGGCTGGGGGTGG - Exonic
1162316371 19:9940839-9940861 TGGCAGAACCAGGATGTTGACGG - Intergenic
1162418142 19:10550587-10550609 TGGCTGCAGCAGAGTGTGGGAGG - Intronic
1162804339 19:13129275-13129297 TGGCTGAAGCAGGGGTGGGATGG - Intronic
1163691591 19:18741576-18741598 TGGCAGAGGGAGGGGGTGTAGGG - Intronic
1163890902 19:20012083-20012105 TGGCAAAAGCAGTGTTAGGAGGG + Intronic
1164518865 19:28961471-28961493 TGGCAGAAGCAGCTCCTGGAAGG + Intergenic
1165081624 19:33310240-33310262 GGGAAGAAGCAGGATGTGAATGG - Intergenic
1165146697 19:33735367-33735389 TGGCAGCAGGAGAGTGTGAATGG + Intronic
1165333185 19:35152701-35152723 TGGGAGGAGGAGGGCGTGGAGGG + Intronic
1165788702 19:38477891-38477913 TGGGAGGTGCAGGGTGGGGAGGG + Intronic
1166258848 19:41624309-41624331 TGGCTGGTGCAGGGTGTGAATGG + Intronic
1167533582 19:50034314-50034336 GGGCAGAAGCAGGGAGTCAAAGG - Intronic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
925015905 2:523931-523953 TGGCAGAAGCCGCCTTTGGAAGG + Intergenic
925237646 2:2293456-2293478 CTGCAGGAGCAGGGCGTGGAGGG + Intronic
925503584 2:4534681-4534703 TGGCAGAAGAGGGGTGAAGAGGG - Intergenic
925897739 2:8486365-8486387 TCACAGAAGCAGAGTGTGAATGG - Intergenic
926450864 2:13002160-13002182 TAGCACATGCAGGGTGTGGTTGG + Intergenic
926707094 2:15844616-15844638 TGGCCGAAGCTGGGTGGGGTGGG - Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
927667896 2:25044811-25044833 GGGCAGAGGCAGGGTGAGGAGGG - Intronic
927865972 2:26587953-26587975 TGGCAGGATATGGGTGTGGAAGG + Intronic
927910903 2:26898868-26898890 TGGCAGGAGAAGGGTGTGTCAGG + Intronic
928127944 2:28629077-28629099 TGGGAGCTGCAGGGAGTGGAGGG - Exonic
929273377 2:39999048-39999070 GGGCAGAAGCAGTGAGTGAAGGG - Intergenic
929768826 2:44874349-44874371 TGGCAGAAGTTGGGGGTGGATGG - Intergenic
929879986 2:45827121-45827143 TGACTGGAGCAGAGTGTGGAGGG - Intronic
930151090 2:48060904-48060926 TGCCTGAGGCAGGGTGGGGAAGG + Intergenic
930554760 2:52881887-52881909 TGGCAACATCTGGGTGTGGAAGG + Intergenic
931224612 2:60319129-60319151 TGGCTGAAGGAGGGTGGGGGTGG - Intergenic
931711561 2:64992345-64992367 TGTCAGAAGCAGGAGGTGAAGGG - Intronic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
932468684 2:71940013-71940035 GGGCAGAAGCAGGGCCAGGAGGG - Intergenic
932709165 2:74049123-74049145 TGGCAGAGGGAGGGGTTGGAAGG + Intronic
932820509 2:74895689-74895711 TGGGAGAAACAGGGGGTTGAGGG - Intergenic
933303153 2:80565595-80565617 TGGTAGAAACAGTGTGTGCATGG + Intronic
934025750 2:88000362-88000384 TGGAAAAAGGAGGGTCTGGAGGG - Intergenic
936084829 2:109460217-109460239 TGGCAGAAGCATTGTGTGTAGGG + Intronic
936646216 2:114375872-114375894 TGGCAGAAGCATTTTGTGCAGGG + Intergenic
936735736 2:115440948-115440970 TGGCAGAAGCGGGTTGGGTAAGG + Intronic
937270711 2:120649829-120649851 AGGCCCAAGCAGGGTGAGGAGGG - Intergenic
937338650 2:121077116-121077138 TGGCAGGTGCAGGTTGTGCAGGG - Intergenic
937505485 2:122531920-122531942 TGTCAGATGCAGGCTGGGGAGGG - Intergenic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
937841100 2:126525458-126525480 TGGCAGAAGCATTGTGTGTAAGG + Intergenic
938132317 2:128727238-128727260 TGACAGAACCAGGTTGTGGCTGG + Intergenic
938197369 2:129340453-129340475 TGACAGCAGCAGGGTGTTAACGG - Intergenic
939432675 2:142130898-142130920 TGCCTGGAGCAGGATGTGGAAGG + Exonic
939439352 2:142224235-142224257 TGGCAGAAGCTTGAGGTGGAGGG - Intergenic
940239015 2:151542919-151542941 TAGCACATGGAGGGTGTGGAAGG - Intronic
940253730 2:151707594-151707616 TGGCAGAAGCAGCAAGTTGAGGG + Intronic
941029926 2:160499585-160499607 TGGAAGAAGCAGGCAATGGAAGG - Intergenic
942045176 2:172095702-172095724 TGGCAGATCCTGGGTGGGGAGGG + Intergenic
942051779 2:172147061-172147083 TGGCAAGAGCGGGGAGTGGAGGG - Intergenic
942193946 2:173498569-173498591 TGCCTGCAGCAGGGTGGGGAAGG - Intergenic
942852279 2:180502680-180502702 TGGCTGTAGCAGGGGGTGGAAGG + Intergenic
942876705 2:180808409-180808431 TAACAGAAGCAGGGTGCTGAAGG + Intergenic
943466600 2:188236173-188236195 TGCCTGAGGCAGGGTGGGGAAGG - Intergenic
944003709 2:194875864-194875886 AGGCAGCAGCAGGGTTTGAAAGG + Intergenic
944492637 2:200273477-200273499 TGACAAAAGAAGAGTGTGGATGG + Intergenic
944931348 2:204523148-204523170 TCTCAGAAGCTGGGTGTGGGTGG - Intergenic
945477186 2:210297786-210297808 GGACAGAAGCAGGGTGTCAAAGG - Intronic
945486758 2:210406212-210406234 TGACAGAAGCAGGTTTTGGAAGG - Intergenic
947010466 2:225560674-225560696 TGGCACAAGCAGGAGCTGGAAGG + Intronic
947506922 2:230714048-230714070 TTGCAGAAGAGGTGTGTGGAAGG + Intronic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947894579 2:233657402-233657424 TGGCAGAAGGTGAATGTGGAAGG + Intronic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
948454468 2:238098367-238098389 TCCCAGAAGCGGGGTGGGGAAGG - Exonic
948770281 2:240248250-240248272 GGGAAGGAGCAGGGGGTGGATGG - Intergenic
948882234 2:240865470-240865492 TTGGAGTAGCAGGTTGTGGACGG - Intergenic
948970596 2:241422635-241422657 TGACAGAAGCAGGCTTTGGAAGG + Intronic
1168891843 20:1300049-1300071 TGGCAGATGCTGGGTCTGCATGG - Intronic
1168893885 20:1310755-1310777 TGGCAGAGGAGGGGTGAGGAGGG + Intronic
1169206012 20:3740765-3740787 TGGCACAAGCAGGGTAGGTATGG - Intronic
1169425873 20:5497047-5497069 TGGCAGCAGCCGGCTCTGGAAGG - Intergenic
1169432094 20:5545603-5545625 TGGCTGAAGCAGGGTGTAAAAGG + Exonic
1169900337 20:10546363-10546385 TCGTAGAAGCAGTGTGTGGCCGG + Intronic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170624341 20:18020003-18020025 TGGTAGAAGCTGGGTGTCTATGG - Intronic
1171406475 20:24915301-24915323 TGGCTGGAGCAGGGTCTGGGGGG - Intergenic
1171489312 20:25505277-25505299 TCACAGGAGCAGGGTGTAGAAGG + Intronic
1173464025 20:43267248-43267270 AGCCAGTAGCAAGGTGTGGATGG + Intergenic
1173542836 20:43867525-43867547 TGGCAGAGGCTGTGTGTGGATGG - Intergenic
1173583549 20:44164748-44164770 TGCCAGGGGCTGGGTGTGGAAGG + Intronic
1174040099 20:47693595-47693617 TGAGAAAAGCAGGTTGTGGAAGG + Intronic
1174774895 20:53334480-53334502 TGGCTGAAGCAGGATGGGGGAGG + Intronic
1175274425 20:57758294-57758316 TGGCATTAGCAGGATGTGGATGG + Intergenic
1175372222 20:58499695-58499717 GGGTGGAAGCAGGGTGTGAAGGG - Intronic
1175816633 20:61886482-61886504 TGGCAGAAGCAGGAAGGGTAGGG + Intronic
1176125714 20:63473576-63473598 TGGCAGGGGCAGGGACTGGAGGG + Intergenic
1176253651 20:64139411-64139433 TGGCAGAAGGCGGGTGGGGGGGG + Intergenic
1176887460 21:14273808-14273830 TGGAGGAGGCAAGGTGTGGAGGG - Intergenic
1177556997 21:22703697-22703719 TGGCAGCAGGAGGGTGGGGTTGG - Intergenic
1178466135 21:32849793-32849815 TTGCAGGAGCAGGGAGGGGAGGG + Intergenic
1178993897 21:37379224-37379246 TGTAAGAAGGAGGGTTTGGAAGG + Intronic
1179101497 21:38358967-38358989 TGGCAGACGGAAGGTGTGGATGG - Intergenic
1179136569 21:38684885-38684907 TGGCAGAAAGATGGTGGGGAGGG + Intergenic
1179166942 21:38942843-38942865 TGGGGGAAGCTGTGTGTGGAAGG - Intergenic
1179188824 21:39106538-39106560 TGCCAGAAGCATGGTCTAGAAGG + Intergenic
1180203868 21:46244845-46244867 TGGCTGAAGCAGGCTGTGCTCGG - Exonic
1180616284 22:17130298-17130320 TGGCCGAACCAGGCTGTGGTGGG - Intronic
1180728221 22:17961801-17961823 TGGCAGCAGCAGGGTTGGGGTGG - Intronic
1180997239 22:19971656-19971678 TGGCCCATGCAGGGTGTGGCCGG + Intronic
1181481688 22:23203951-23203973 TGGCAGAAGCTGGGCTGGGACGG + Intronic
1181904607 22:26184354-26184376 TGGCAGAAGTGGGGTGGAGAGGG - Intronic
1181930067 22:26393958-26393980 GGGCAGATGGAGGATGTGGAGGG + Intergenic
1182092109 22:27602839-27602861 TGGCGGCAGTAGGGTGGGGAGGG + Intergenic
1182458209 22:30466052-30466074 TGCCAGAAGCAGTCTGGGGAGGG + Intronic
1182686211 22:32122983-32123005 TGCCAGAGGCAGGGAGTGCATGG + Intergenic
1182774642 22:32821834-32821856 AATCAGAAGCAGGGAGTGGAAGG - Intronic
1183291010 22:37002088-37002110 TGGCAGCAGTCGGGGGTGGAGGG + Exonic
1183703590 22:39463471-39463493 TGGCAGAAGGAGGGCCTTGAAGG - Intronic
1184189118 22:42883193-42883215 TGGCAGGAGCAGGGTGAGGCTGG - Intronic
1184429091 22:44430762-44430784 TGGCACAAGTAGGCTGAGGATGG - Intergenic
1184556890 22:45238269-45238291 TGGCAGATGAAGGGCGTGGAGGG - Intronic
1184628407 22:45755999-45756021 TGGCAGAAGGAGGAGGTGGGTGG - Intronic
1185014565 22:48335455-48335477 TGTCAGAAGCTGGGAGTGGAGGG - Intergenic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
950636543 3:14319442-14319464 TGGGAAAAACTGGGTGTGGAGGG + Intergenic
951139696 3:19146859-19146881 CGGCAGAAGCAGGGTGCAGCTGG + Intergenic
952134451 3:30400968-30400990 GGGCAGAAGCATGGAGAGGATGG - Intergenic
953010003 3:39016075-39016097 TGAGAGAAGCAGGGTAGGGAAGG + Intergenic
953046146 3:39295549-39295571 TGTCAGAAGCAGGTTCTGGCTGG + Intergenic
953081179 3:39619964-39619986 TGACAGAAGTAGGCTTTGGAAGG - Intergenic
953097050 3:39788417-39788439 TTGCAGCAGGAGGCTGTGGATGG - Intergenic
953468410 3:43145861-43145883 TGGCAGAAGCACTGTGAGCAGGG - Intergenic
953740749 3:45536826-45536848 TGACAGAAGCATGTGGTGGATGG + Intronic
954504710 3:51058709-51058731 TGGCAGAATCAGTGTCTGGTGGG + Intronic
954531216 3:51321488-51321510 TGACAGAAGTAGGCTTTGGAAGG + Intronic
955864918 3:63372258-63372280 GGTGAGAAGCAGGGGGTGGAAGG - Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
957459115 3:80494517-80494539 TGGAAGAAGTTGGGGGTGGAGGG - Intergenic
957999230 3:87730628-87730650 TGGGGGATGCATGGTGTGGAGGG - Intergenic
958417764 3:93895414-93895436 TGGCAGAAATAAAGTGTGGAAGG + Intronic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
961333284 3:126155366-126155388 AGGCAGGATGAGGGTGTGGAGGG + Intronic
961435267 3:126912446-126912468 TGGCAGCAGCTGGCTGTGGTGGG + Intronic
961523300 3:127480725-127480747 TGGCAGAATCTGGGTGTTTATGG - Intergenic
962047572 3:131776830-131776852 TGGCAGAGGGAGGATGAGGAAGG - Intronic
963011135 3:140771608-140771630 TGGTAGAAGCAGGGTTTTGGGGG - Intergenic
963389676 3:144644185-144644207 GAGCAGAAGGAGGGTGTGGTAGG + Intergenic
963661543 3:148133237-148133259 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
964626157 3:158762049-158762071 TGGCAGGAGCAGGATGGGGAAGG + Intronic
964806974 3:160620922-160620944 TAGCAGAAGTAGGGGGTAGAAGG + Intergenic
967420983 3:189272576-189272598 TGGCAGAAGAAGTCTGTGGTTGG - Intronic
967929717 3:194682137-194682159 TGGCAGCAGCAGCCTGTGGCTGG + Intergenic
968599548 4:1502533-1502555 TGGCAGAGGCAGGGGATGGGTGG + Intergenic
969479936 4:7442075-7442097 GGGCTGAAGGAGGGGGTGGAGGG - Intronic
969479991 4:7442220-7442242 GGGCTGAAGGAGGGGGTGGAGGG - Intronic
969500989 4:7552812-7552834 GGGAGGAATCAGGGTGTGGAGGG + Intronic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
971026268 4:22591334-22591356 TGGCAGAGGCAGGGAGAGGTAGG - Intergenic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
972436296 4:39038749-39038771 AGGCAGGAGAATGGTGTGGAGGG - Intergenic
973533625 4:51858444-51858466 TAGCAGATGCAGGGTGTACAAGG + Intronic
973713278 4:53650344-53650366 GGGCCTAAGCAGGGTGCGGAGGG + Intronic
973839677 4:54848329-54848351 TGGCAGAAGCACTGTTTGGAAGG + Intergenic
973959685 4:56097291-56097313 TGGAAGATGAATGGTGTGGAAGG + Intergenic
974705818 4:65514169-65514191 TGTCAGGAGCATGGTCTGGAAGG - Intronic
974836982 4:67262928-67262950 TGGCAGTAGCAGAGATTGGAGGG - Intergenic
976199225 4:82562166-82562188 GGGCAGGAGCCGGGTGTGGGCGG + Exonic
976335801 4:83884711-83884733 TTGCAGAGGAAGGGTGTGGTTGG - Intergenic
977891090 4:102312441-102312463 AGTCAGAAGCAGGGTGTGAGAGG - Intronic
979488530 4:121297023-121297045 TGGGAGCAGGAGGGTGGGGATGG + Intergenic
981605762 4:146538304-146538326 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
983845647 4:172514588-172514610 GGGCAGAATCTGGGGGTGGAGGG - Intronic
984623389 4:181978290-181978312 TGGCAGAACCAGGATGAGAAGGG + Intergenic
985966365 5:3341631-3341653 TGGGAGCAGGAGGCTGTGGAGGG - Intergenic
986011762 5:3723703-3723725 TGACAGAAGCAGGCTTTAGAAGG - Intergenic
986163139 5:5249567-5249589 TGGCGGAAGCAGGCTTTGCACGG + Intronic
986261481 5:6151424-6151446 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
986648466 5:9941162-9941184 TGGGAGAGGCTGTGTGTGGAGGG - Intergenic
987694034 5:21304967-21304989 TGGCCGAAGCAGGGGGAAGAGGG - Intergenic
988205145 5:28124253-28124275 TGGCAGAAGCACTGCGTGCAAGG + Intergenic
988960546 5:36366802-36366824 TGGTTGAAGCTGGGTGAGGAAGG - Intergenic
989579351 5:43017509-43017531 GGGCAGAGGGATGGTGTGGAAGG + Intergenic
990173473 5:53081137-53081159 TGTTAGAACCATGGTGTGGATGG - Intronic
990301740 5:54455750-54455772 TGGCAGAAGGAGGCTGTTCAAGG + Exonic
990302286 5:54460773-54460795 TGGCAGCAGCATGGTCTGGGAGG + Intergenic
991746214 5:69744564-69744586 TGGCCGAAGCAGGGGGAAGAGGG + Intergenic
991751491 5:69810677-69810699 TGGCCGAAGCAGGGGGAAGAGGG - Intergenic
991797816 5:70324517-70324539 TGGCCGAAGCAGGGGGAAGAGGG + Intergenic
991825592 5:70619878-70619900 TGGCCGAAGCAGGGGGAAGAGGG + Intergenic
991830778 5:70685571-70685593 TGGCCGAAGCAGGGGGAAGAGGG - Intergenic
991890159 5:71323836-71323858 TGGCCGAAGCAGGGGGAAGAGGG + Intergenic
992750640 5:79857557-79857579 TGGCAGAAGAATGGAGAGGAGGG - Intergenic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
994622801 5:102182820-102182842 TGGATGAAGCAGGCTATGGAGGG + Intergenic
994902007 5:105785606-105785628 TGACACAAGAAGGGTGTGGCTGG - Intergenic
996057921 5:119000952-119000974 TGCCTGAGGCAGGGTGGGGAAGG + Intergenic
996381577 5:122867326-122867348 TGGCAGAAGCATTGTGTGCAGGG + Intronic
997251720 5:132393733-132393755 TGGGAGAAACAAGGTGAGGATGG - Exonic
997261199 5:132466651-132466673 TGGCAGCTGCTGGGTGTGAACGG + Intronic
997431671 5:133845124-133845146 TCACAGAGGCAGGGTGTGGATGG + Intergenic
997460759 5:134050820-134050842 TGGCAGAGTCAAGGTGGGGATGG + Intergenic
999093670 5:148958977-148958999 TGGCAGCAGCGGGGTGGGGGTGG - Intronic
999471420 5:151858260-151858282 AGGCAAAAGAAGGGAGTGGAAGG + Intronic
999563660 5:152833548-152833570 TGGCCGAAGCAGGGGGAAGAGGG + Intergenic
999672110 5:153966899-153966921 TGGAAGAATGAGGGTGTGGTTGG - Intergenic
1000638297 5:163669347-163669369 TGCCAGAAGCAGGACATGGAAGG + Intergenic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001307700 5:170587643-170587665 TGACAGAAGCAGAGATTGGAGGG - Intronic
1001433508 5:171681848-171681870 TGGCAGACCAAGGGTGGGGACGG - Intergenic
1002842947 6:921893-921915 TGTCAGAAACAGTGTGTGGCGGG - Intergenic
1003534766 6:6967138-6967160 GGGGAGAAGCTGGGTGTGTAAGG - Intergenic
1004009910 6:11674382-11674404 TAGAAGAAACTGGGTGTGGAGGG - Intergenic
1004620400 6:17326101-17326123 GGGCAGGAGCATGGGGTGGAAGG + Intergenic
1004627448 6:17390203-17390225 TGGCAGGAGCAAGGGGAGGAGGG - Intergenic
1005168686 6:22956178-22956200 TAGCAGAAGCTGGGGGAGGAGGG + Intergenic
1005200950 6:23343172-23343194 TGCCACAGGGAGGGTGTGGAGGG - Intergenic
1006291189 6:33138107-33138129 TGTCTGCAGCAGGGTGGGGAAGG + Intergenic
1006394126 6:33776019-33776041 TGACAGAACCAGGGTGGGGGAGG - Intronic
1006456850 6:34136916-34136938 GAGCAGAGGCAGGGTGTGGTGGG + Intronic
1006942634 6:37763072-37763094 TGGCAGAGTCAGGCTGGGGAGGG + Intergenic
1006986446 6:38178730-38178752 TGGGAGCAGCAGGGTGTGGGGGG + Intronic
1007288514 6:40765925-40765947 GGGCAGGAAGAGGGTGTGGAGGG - Intergenic
1007662275 6:43494297-43494319 TGGCAGAAGCTGGGGTTGGATGG + Intronic
1007951634 6:45877871-45877893 TGGCAGAACCAGGGTGTAGCTGG + Intergenic
1008085151 6:47236597-47236619 AAGCAGCAGCAGGGTGTGGGTGG - Intronic
1008663664 6:53695158-53695180 AGGCCAAAGCAGGGTGAGGAGGG + Intergenic
1009512935 6:64575472-64575494 TGGCAGAAGCAAGGAGTCCAGGG + Intronic
1010116809 6:72322305-72322327 TGGCAGAAGCAGGGTATTGGGGG + Intronic
1010428276 6:75749553-75749575 TGGGAGAAGCAGGTGATGGATGG + Intronic
1011277162 6:85642766-85642788 TGCCAGAACCTGGGTGTGGGAGG - Intronic
1011478946 6:87775422-87775444 TGCAAGAACCAGGGTTTGGAAGG + Intergenic
1011487373 6:87856674-87856696 TGGCATAAGGTGGGTGTGGCAGG + Intergenic
1012402942 6:98859381-98859403 TGGCAGAAGCATTGTGTGCGGGG + Intergenic
1012986489 6:105881770-105881792 TGGCAAAAGCAGGGTTAGGATGG - Intergenic
1013245544 6:108283840-108283862 TGACAGCAGTATGGTGTGGAGGG + Intergenic
1013538256 6:111083248-111083270 TTTCAGAAGCAGGGTCTGCAGGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1015391764 6:132690381-132690403 AGGCAGGAGCAGGGTCTGCAGGG - Intronic
1015527537 6:134187776-134187798 TGGCAGAAGCATTGTGTTCAAGG + Intronic
1015638297 6:135302761-135302783 AGGCAGAAGCAGGGGGAAGAAGG + Intronic
1016295837 6:142572942-142572964 TGTCTGCAGCAGGGTGGGGAAGG - Intergenic
1016646271 6:146412065-146412087 AGGCAGAAGGAGGGGATGGAGGG - Intronic
1017043929 6:150329847-150329869 TGGCAGAAGCATTATGTGCAGGG + Intergenic
1017300017 6:152846179-152846201 TTGCAGAGGCTGGGAGTGGAAGG + Intergenic
1017384049 6:153861936-153861958 TGGCAGCAGCAGGCTGAGCATGG - Intergenic
1017643475 6:156516731-156516753 GGGCAGGGGCAGGGTGGGGAAGG - Intergenic
1017701485 6:157077415-157077437 TGGCAGAGGCAGGCTGCGCATGG - Intronic
1017984622 6:159432720-159432742 TGGGAGAAGAGGGGTGTAGATGG + Intergenic
1018185261 6:161261126-161261148 TGGCTTAAGCAGGGGTTGGAAGG - Intronic
1018967844 6:168502421-168502443 GGGCAGATGCAGGGCATGGAGGG - Intronic
1019119994 6:169794654-169794676 TGGCAGGTGCAGGGGGTGAAGGG + Intergenic
1019164209 6:170087805-170087827 TGGGAGGAGCATGGTGTGGGGGG + Intergenic
1019493182 7:1324487-1324509 TGGGAGGGGCAGGGGGTGGAGGG + Intergenic
1020583179 7:10031541-10031563 TAGCAGAAGCATTGTGTGCAGGG + Intergenic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1020846374 7:13289588-13289610 TGGCTGAAGCAGGGTATGTAGGG - Intergenic
1021223275 7:17999171-17999193 TATCAGAAGCAAGGGGTGGATGG - Intergenic
1021922302 7:25497531-25497553 TGGAAGAAGCTGGGAGTGGCAGG - Intergenic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1022967637 7:35488108-35488130 TGCCAGTTGCAGGGTGTGGCTGG - Intergenic
1024512268 7:50213312-50213334 GGGCAGGAGCAGGGTGTACATGG + Intergenic
1024613442 7:51086506-51086528 TGGCAGAGGCAGGGTGTTGCAGG - Intronic
1025175803 7:56801871-56801893 AGGCAGAGGCAGGGTCTGTACGG + Intergenic
1025695989 7:63774551-63774573 AGGCAGAGGCAGGGTCTGTACGG - Intergenic
1026024191 7:66732061-66732083 TGGCAGAAGCAGGCTGGGCTGGG - Intronic
1026054241 7:66970817-66970839 TGGCTGGAGCTGGATGTGGAGGG + Intergenic
1026135697 7:67658599-67658621 TGGAAGAAGCAGGGTGGTGGTGG - Intergenic
1026589863 7:71685247-71685269 TGGCAGAAGCAGGTGGTTCAGGG + Intronic
1026888915 7:73970953-73970975 TGGCAGAAGCAGGCTGGGCTGGG - Intergenic
1026935826 7:74254690-74254712 TGGGAGGAGCAGGGCCTGGAGGG + Intergenic
1027389835 7:77693958-77693980 TGGCATAAGTTGAGTGTGGAAGG + Intergenic
1028172166 7:87611238-87611260 TGACAGAAGACTGGTGTGGATGG - Intronic
1028270657 7:88784687-88784709 AGGCAGAAGCAGGATTTGGTGGG - Intronic
1028292533 7:89083993-89084015 TGGCAGAAGCTGGGGATAGATGG + Intronic
1028548994 7:92035793-92035815 TGGGAGAAGCAGGCTGTAGTGGG + Intronic
1029098355 7:98107036-98107058 TGGCAGAAGCAACGTGTGCTCGG + Exonic
1029364157 7:100106628-100106650 GGGCAGAGGCAGGGAGAGGAAGG - Intronic
1029485320 7:100836548-100836570 GGGCAGCAGCTGGATGTGGAAGG - Intronic
1029817115 7:103107410-103107432 TGACAGAAGCAGGCTTTAGAAGG + Intronic
1030353538 7:108518330-108518352 TGCCAAAAGCAGTGTGTAGAAGG + Intronic
1031106858 7:117554433-117554455 TGGGAGAAACAGGTTTTGGATGG + Intronic
1031468740 7:122144512-122144534 TGGCAGAAGGCGGGCGGGGACGG + Intergenic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1032032713 7:128497803-128497825 TGGCAGAAGCAGGCTGTCCTTGG + Intronic
1032356843 7:131219037-131219059 TGCCAGAAGCTGGGGGAGGAAGG + Intronic
1032832700 7:135644211-135644233 TGGCAGGAACAGGGTGAGGCAGG + Intronic
1033578071 7:142705015-142705037 TGCCTGAGGCAGGGTGGGGAAGG - Intergenic
1033763745 7:144464957-144464979 TGCCTGAGGCAGGGTGGGGAAGG - Intronic
1034282515 7:149864039-149864061 TGGGCGAAGCTGGATGTGGAAGG + Intronic
1034339985 7:150346727-150346749 TGGCGGTAGGAGGGTGAGGAGGG + Intergenic
1034357118 7:150459862-150459884 TGGCAAAAGCATTGTGTGCAGGG + Intronic
1034447256 7:151120035-151120057 TGGCTGATGCTGGGGGTGGAGGG - Exonic
1034788864 7:153949885-153949907 AGGCTGAAACAGGGTCTGGAGGG + Intronic
1035114361 7:156510354-156510376 TGTAAGAAGGAGGTTGTGGAGGG + Intergenic
1035185821 7:157125329-157125351 TGGCAGAACAAGGGCCTGGAGGG - Intergenic
1036229306 8:6985900-6985922 TGGCAGGAGCATGGGGTGGAGGG + Intergenic
1036231758 8:7005004-7005026 TGGCAGGAGCATGGGGTGGAGGG + Intronic
1036593192 8:10187412-10187434 CGGCAGAAGCTGGTGGTGGAAGG - Intronic
1036619595 8:10415809-10415831 AGGCAGGAGTAGGGTGTGAAGGG - Intronic
1036772991 8:11591888-11591910 TGGCAGTAGAAGGGTATGGATGG - Intergenic
1037589691 8:20302712-20302734 TGGCAGCGGGACGGTGTGGAGGG + Intronic
1037654570 8:20872107-20872129 TGGCAGGGGCAGGGTGTGCAGGG + Intergenic
1037784293 8:21893386-21893408 TGGCAGAAGGAGGGAGTGAGTGG - Intergenic
1039884767 8:41648624-41648646 TGGCGGAAGCCGGGGGTGGAGGG - Intronic
1039894582 8:41707462-41707484 TGGCTGCAGCAGTGTGTGGTGGG - Intronic
1040313872 8:46250764-46250786 TGAGAGACGCAGGGTGTGGTGGG + Intergenic
1040355792 8:46617341-46617363 TGGCAGCAAGAGGGTGCGGAAGG - Intergenic
1041512425 8:58666610-58666632 AGGCAGAAGCAGGTTGGGAATGG + Intergenic
1041625873 8:60025942-60025964 AGGAAGAAGCAGGGTGTGTGTGG - Intergenic
1042226880 8:66521144-66521166 GGGCAGCAGCAGGGTGAGGGTGG + Intergenic
1042312076 8:67388798-67388820 TGGCAGGAGCAGGAGGAGGAGGG - Intergenic
1042986515 8:74589785-74589807 TGACTGGAGAAGGGTGTGGAGGG + Intergenic
1046294984 8:112206252-112206274 TACCAGAAGCTGGGTGTGGAAGG + Intergenic
1046635403 8:116669900-116669922 TGGTAGAAGCAGAGTGTGTAGGG - Intronic
1047253085 8:123195247-123195269 TGGGATAAGCTGGGAGTGGAAGG + Intronic
1047682600 8:127269703-127269725 GTGCAGAAGCAGGATTTGGATGG - Intergenic
1047884282 8:129231385-129231407 TGGCAGAAGCATTATGTGTAAGG - Intergenic
1048211513 8:132458034-132458056 TGCCATAAGGAGGATGTGGATGG - Intronic
1048981811 8:139706465-139706487 TGGCACATGTGGGGTGTGGACGG - Intergenic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049372020 8:142272476-142272498 TGGAAGAAGGAAGGTGTAGACGG - Intronic
1049790465 8:144470014-144470036 TGGCAGGAAAAGGGTGGGGAAGG - Intronic
1050441132 9:5665419-5665441 TGACAGAAGTAGGCTTTGGAAGG - Intronic
1050766713 9:9143361-9143383 AGGCAGTGTCAGGGTGTGGAAGG - Intronic
1052577427 9:30307594-30307616 TGGCAGAAGAATGGTGTGCAGGG - Intergenic
1052637554 9:31123491-31123513 TGCCAGAAGATGGGTGGGGAGGG + Intergenic
1052734978 9:32332703-32332725 TGGCAGAAGCAGAATATGGTTGG + Intergenic
1052891552 9:33704827-33704849 TGCCTGAGGCAGGGTGGGGAAGG - Intergenic
1052895357 9:33742540-33742562 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1053476416 9:38385164-38385186 TGACAGTAGAAGGGTGAGGATGG - Intergenic
1053565298 9:39243175-39243197 TGTCAGAGGCAGGGGGAGGAGGG - Intronic
1053618383 9:39792480-39792502 TGGCAGGAACAGCTTGTGGATGG - Intergenic
1053831067 9:42081024-42081046 TGTCAGAGGCAGGGGGAGGAGGG - Intronic
1054131853 9:61375864-61375886 TGTCAGAGGCAGGGGGAGGAGGG + Intergenic
1054599482 9:67106414-67106436 TGTCAGAGGCAGGGGGAGGAGGG + Intergenic
1054922584 9:70556736-70556758 TGGCAGAGTCAGGGTTTTGAGGG - Intronic
1055257933 9:74394416-74394438 TGGAAGGAGCAGTGTGTGCAAGG - Intergenic
1056010737 9:82327441-82327463 TGGCAGAAGCAGGCTTCAGAAGG - Intergenic
1056262099 9:84859157-84859179 TGGGAGAAGCGGGGTGTGAATGG + Intronic
1057034151 9:91799572-91799594 TGGCAGAGGCAGGCTCTGCATGG - Intronic
1057598052 9:96433423-96433445 GGTCAGAAGCTGGGTGTGGTGGG + Intergenic
1057624077 9:96661960-96661982 TGGCAGAAGCACGGTGTACTGGG + Intergenic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057958073 9:99427572-99427594 TGGGAGAAGAAGGGTGTGAATGG + Intergenic
1058412325 9:104747675-104747697 TGGCAGACGCAGGCTGGGGCGGG - Exonic
1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG + Intergenic
1058553226 9:106138134-106138156 AGGCAGAAGGAGGAGGTGGAAGG - Intergenic
1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG + Intronic
1059259398 9:112961500-112961522 TGGGAGAAGCAGGAGGTAGAGGG - Intergenic
1059592599 9:115678331-115678353 TGGCAGAAGCATTGTATGCAGGG - Intergenic
1060398336 9:123332094-123332116 TGGCAGAAGCAGGTTCAAGATGG + Intergenic
1060504447 9:124187563-124187585 TGGGGGATGGAGGGTGTGGATGG - Intergenic
1060604326 9:124900287-124900309 GGCCAGCAGCAGGGGGTGGAGGG - Intronic
1060873109 9:127058472-127058494 TGGCAGGATCAGGGTATGGCTGG + Intronic
1060912733 9:127363612-127363634 TGGGAGGAGCACAGTGTGGACGG + Intronic
1061309418 9:129752600-129752622 TGAGAGAAGCAGGTTCTGGAGGG - Intronic
1061787095 9:133036041-133036063 TTGCAGAAGGAGGGTCAGGAAGG - Intronic
1061936121 9:133858585-133858607 TGACAGTAGCAGGGTGTGTGTGG - Intronic
1062027939 9:134349177-134349199 TTGCAGAAGAAGGGTCTGGCTGG + Intronic
1062119971 9:134829238-134829260 GGGCAGCAGCAGGGGCTGGAGGG + Intronic
1185731165 X:2463087-2463109 TGGCAGATTCAGTGTGTGGTGGG - Intronic
1186317534 X:8386958-8386980 TGGCAAAAGAAAGGGGTGGAGGG + Intergenic
1187011343 X:15283538-15283560 TGGCAGATGTAGCTTGTGGATGG + Exonic
1187124825 X:16445293-16445315 TGGCAGAAGCAGGGGGCCAAGGG - Intergenic
1188133907 X:26470997-26471019 TGCCTGAGGCAGGGTGGGGAAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188442523 X:30227242-30227264 TACCAGAGGCAGGGTGGGGAGGG - Intergenic
1188757321 X:33978295-33978317 TGACAGATGCATGGAGTGGAAGG - Intergenic
1189301990 X:39958725-39958747 GGGCAGAGGCAGGCTGTGGGTGG - Intergenic
1189319978 X:40082090-40082112 TGGCAGAAGGGGGGCGTCGAGGG + Intronic
1189943497 X:46152819-46152841 AGGCAGAAGGAGGTTGTGGGAGG - Intergenic
1190172127 X:48119993-48120015 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190189664 X:48266746-48266768 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1190196891 X:48327370-48327392 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190205949 X:48402755-48402777 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190658426 X:52633250-52633272 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190659907 X:52644756-52644778 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190676824 X:52789588-52789610 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1190712683 X:53081601-53081623 GGGCAGAAGCGGGGGGTGAAGGG + Intergenic
1191177200 X:57516915-57516937 TAGTGGAAGGAGGGTGTGGATGG + Intergenic
1191613022 X:63136870-63136892 TGCCTGAAGCAGAGTGGGGAAGG - Intergenic
1191623275 X:63242056-63242078 TGCCTGAAGCAGAGTGGGGAAGG + Intergenic
1191631421 X:63325958-63325980 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1192730669 X:73800057-73800079 TGCCTGAGGCAGGGTGGGGAAGG + Intergenic
1194086247 X:89532295-89532317 TGTCTGTAGCAGGGTGGGGAAGG + Intergenic
1194187716 X:90793722-90793744 TGCCTGTGGCAGGGTGTGGAAGG - Intergenic
1194626731 X:96234099-96234121 TGGCAGAAGCATTGTGTGTAGGG - Intergenic
1195731281 X:107970355-107970377 GGGAAGAAGCAGGGTGTGGACGG - Intergenic
1196778100 X:119359613-119359635 TGGCAGACTCAGGGAGTGGAGGG + Intergenic
1198170152 X:134097333-134097355 TGGTAGAAGCATTGTGTGCAGGG - Intergenic
1198430094 X:136556729-136556751 AGGAGCAAGCAGGGTGTGGATGG - Exonic
1198496848 X:137201984-137202006 TGTCAGAAGCTGGGTGTTGCTGG - Intergenic
1198710293 X:139494552-139494574 GGGGAGGAGCAGGGTGTGGTAGG - Intergenic
1199021385 X:142882195-142882217 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
1199308109 X:146291851-146291873 TGGCAGAAGTAGGCTTTAGAAGG - Intergenic
1199732448 X:150649403-150649425 AGGCAAAAGCAGGTTGTGAAAGG - Intronic
1200052637 X:153443075-153443097 GGGCAGAAGCAGAGCATGGAGGG - Intergenic
1200438907 Y:3188172-3188194 TGTCTGTAGCAGGGTGGGGAAGG + Intergenic
1200534303 Y:4375674-4375696 TGCCTGTGGCAGGGTGTGGAAGG - Intergenic
1200860357 Y:7985010-7985032 TGGCAGAAGCCGGGTTTTCATGG + Intergenic
1200972689 Y:9172586-9172608 TTGCTGGAGCAGGCTGTGGAAGG + Intergenic
1201795068 Y:17887541-17887563 TGGCTGCAGCAGGCTGTAGAAGG + Intergenic
1201806487 Y:18018440-18018462 TGGCTGCAGCAGGCTGTAGAAGG - Intergenic
1202050580 Y:20776324-20776346 GGGCAGTAGCAGGATGTGGGTGG + Intronic
1202138327 Y:21691629-21691651 TGGCTGGAGCAGGCTGTGGAAGG - Intergenic
1202166159 Y:21990990-21991012 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202172231 Y:22061965-22061987 TGGAAGGAGCAGACTGTGGAAGG - Intergenic
1202219133 Y:22524406-22524428 TGGAAGGAGCAGACTGTGGAAGG + Intergenic
1202225199 Y:22595383-22595405 TGGCTGAAGCATAGTGTGGAAGG - Intergenic
1202317915 Y:23600278-23600300 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202356508 Y:24056616-24056638 TGGCTGCAGCAGGCTGTAGAAGG + Intergenic
1202514270 Y:25613493-25613515 TGGCTGCAGCAGGCTGTAGAAGG - Intergenic
1202552851 Y:26069780-26069802 TGGCTGAAGCATAGTGTGGAAGG - Intergenic