ID: 1126330097

View in Genome Browser
Species Human (GRCh38)
Location 15:47522648-47522670
Sequence TATCCTCTCAGTATAGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126330097_1126330102 14 Left 1126330097 15:47522648-47522670 CCGCCCACTATACTGAGAGGATA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1126330102 15:47522685-47522707 CTGCCTTTGTGGCCTTTGTGTGG 0: 1
1: 0
2: 4
3: 26
4: 217
1126330097_1126330101 3 Left 1126330097 15:47522648-47522670 CCGCCCACTATACTGAGAGGATA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1126330101 15:47522674-47522696 TGTTAGCGACACTGCCTTTGTGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126330097 Original CRISPR TATCCTCTCAGTATAGTGGG CGG (reversed) Intronic
900589104 1:3451867-3451889 TCTCCTCTCAGTTAAGCGGGGGG + Intergenic
907946203 1:59138867-59138889 TATCCTCCCATTATAGAGGAGGG + Intergenic
909697301 1:78482261-78482283 TATAATCTCAGTATTTTGGGAGG - Intronic
912163935 1:107019908-107019930 TTTCCTCTCAGTTTAGGGGAAGG + Intergenic
917163325 1:172082079-172082101 TATTCTCTCAGTAAAGTAGTTGG + Intronic
918194636 1:182209882-182209904 TAGCCTCGCAGGATGGTGGGGGG + Intergenic
923802547 1:237224599-237224621 TATAATCTCAGTACTGTGGGAGG + Intronic
1063033738 10:2263501-2263523 CATACTCTCAGTTTAGTGTGGGG - Intergenic
1071206680 10:83288193-83288215 TATATTCCCAGTATAGTTGGAGG + Intergenic
1080555366 11:33411226-33411248 TATCATCTCAGATTAGAGGGTGG - Intergenic
1083608881 11:63995706-63995728 GATCCTCTGAGGATTGTGGGAGG + Intronic
1084973592 11:72784414-72784436 TATCCTCTGAGAATTGTGGCAGG + Intronic
1090777606 11:129979187-129979209 TATCCTCACAAGATAGTAGGTGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092142361 12:6192663-6192685 TATCATCTCAGCACTGTGGGAGG - Intergenic
1099628463 12:85108586-85108608 AATTCTCTCAGTATTCTGGGAGG - Intronic
1099664093 12:85604317-85604339 TCTCCTCTCTGTTTTGTGGGAGG + Intergenic
1100525366 12:95414169-95414191 TGTCATCTCAGTATTTTGGGAGG + Intergenic
1100866022 12:98857598-98857620 CATGCTCTCGGTGTAGTGGGAGG + Intronic
1104852250 12:131882620-131882642 TATCCCCTCAGGAAAATGGGAGG + Intergenic
1109057638 13:57572097-57572119 TATACTCTCAGCACTGTGGGAGG - Intergenic
1109338968 13:61029601-61029623 AATGCTCTCAATAGAGTGGGAGG + Intergenic
1109647878 13:65283813-65283835 TATCCAATCAGAAGAGTGGGGGG + Intergenic
1111094246 13:83490543-83490565 TATCATCTCAGCATTTTGGGAGG - Intergenic
1112697951 13:101971626-101971648 TATAATCCCAGTATATTGGGAGG - Intronic
1118203650 14:63701238-63701260 TCTCATCTCAGTACTGTGGGAGG - Intronic
1119354313 14:73992744-73992766 TATCATCTCAGCATTTTGGGAGG + Intronic
1122148182 14:99706561-99706583 TATCCTCTCTGTGGAGAGGGAGG + Intronic
1124556502 15:30730911-30730933 TATACTCCCAGAATGGTGGGTGG + Intronic
1124578863 15:30934004-30934026 TATACTCTCAGCATTTTGGGAGG - Intronic
1126330097 15:47522648-47522670 TATCCTCTCAGTATAGTGGGCGG - Intronic
1127537276 15:59901764-59901786 TATCTTATCTGTAGAGTGGGTGG + Intergenic
1128507725 15:68288084-68288106 TATCATCTCAGTACTTTGGGAGG - Intronic
1130290763 15:82598526-82598548 TATAATCTCAGTATTTTGGGAGG + Intronic
1131897207 15:97046739-97046761 TATTCTCTCAGTCTCGTGTGTGG + Intergenic
1134129582 16:11640110-11640132 TGTCCTCTCAGTAGAAAGGGAGG + Intergenic
1135931379 16:26740455-26740477 TCTCCTCTCAGTGTGGTGGTTGG - Intergenic
1137368972 16:47887155-47887177 AATCCTGTCAGGAAAGTGGGTGG - Intergenic
1138169947 16:54839485-54839507 TATAATCTCAGTATTTTGGGAGG + Intergenic
1140683418 16:77409142-77409164 TATCCTCTGAGGATAATGGGAGG + Intronic
1143303255 17:5926697-5926719 TATCCTCACTTTATAGTGGGTGG + Intronic
1146767732 17:35539068-35539090 TATAATCTCAGTATTTTGGGAGG + Intergenic
1150053553 17:61989725-61989747 TATAATCTCAGTATTTTGGGAGG - Intronic
1150923635 17:69509807-69509829 AAACCTCTCAGTATACTGAGAGG + Intronic
1150923636 17:69509810-69509832 GAACCTCTCAGTATACTGAGAGG - Intronic
1157918633 18:51694061-51694083 TTTCTTCTCAGTAAAGTGAGTGG + Intergenic
1161057908 19:2199898-2199920 TTTCCTCTCAGAAGAGTGGAGGG + Exonic
1163808792 19:19417401-19417423 TCTCTTCTCAGAATAGTGGGTGG - Intronic
1166345858 19:42165289-42165311 TCTGCTCTCAATAGAGTGGGCGG + Intronic
1167562043 19:50231816-50231838 TATCCTCACTGTCAAGTGGGTGG - Intronic
925946100 2:8865321-8865343 TATCATCTCTGTAAAGTAGGAGG - Intronic
927818495 2:26242144-26242166 TATAATCCCAGTATATTGGGAGG - Intronic
928086303 2:28348333-28348355 TCTCCCCTCTGTCTAGTGGGTGG - Intergenic
928426287 2:31180912-31180934 TATCCTTTCAGGTTTGTGGGTGG - Intronic
931653966 2:64493043-64493065 TATACTTTGAGTATAATGGGAGG + Intergenic
935897272 2:107750885-107750907 GATGCTCTGAGTATAGGGGGTGG + Intergenic
937102829 2:119284641-119284663 TATACTCTCCATATAGTGGGTGG + Intergenic
941611766 2:167669863-167669885 TATCCCCTCAGTGTTCTGGGTGG - Intergenic
943752749 2:191526681-191526703 TATTCTCAAAGTGTAGTGGGAGG - Intergenic
944965011 2:204921428-204921450 TATAATCAAAGTATAGTGGGAGG + Intronic
947992626 2:234498517-234498539 AATCCACTCAGTAGAGTGGATGG - Intergenic
1174659545 20:52199619-52199641 TATAATCTCAGTATTTTGGGAGG + Intronic
1175427826 20:58880896-58880918 CATCCACTCAGTTTATTGGGTGG - Intronic
1183451519 22:37898554-37898576 TCTCCTCTCAGTGTACTGAGAGG + Intergenic
1184224187 22:43119718-43119740 CATCCTCTCAGTACTTTGGGAGG + Intronic
951914226 3:27782421-27782443 TCTCCTCTCAGTATGGTAGTTGG - Intergenic
955373212 3:58371589-58371611 TAGCCTCTAAGAATAGAGGGTGG + Intronic
955969318 3:64421407-64421429 TGTCATCTCAGTACATTGGGAGG + Intronic
959633684 3:108537258-108537280 TGTCCTCTCAGGAGAGTGTGTGG - Intergenic
962951526 3:140224059-140224081 TACCCTTACAGTATAGTGAGTGG + Intronic
967060053 3:185864206-185864228 TATAATCTCAGTATTTTGGGAGG + Intergenic
970714961 4:18911043-18911065 TATAATCTCAGTATTTTGGGAGG + Intergenic
971594423 4:28510304-28510326 TATCCTCTCTGTATAGAAAGGGG - Intergenic
972155198 4:36152652-36152674 TATCACTTCAGTATGGTGGGGGG - Intronic
973729941 4:53813461-53813483 TATAATCTCAGTACTGTGGGAGG + Intronic
974440358 4:61908045-61908067 TATACTCTCAGTGTTTTGGGAGG + Intronic
977699965 4:100010290-100010312 TATAATCTCAGTATTTTGGGAGG - Intergenic
980828703 4:138103683-138103705 TAACCTCTAAGTATAGTGTCTGG - Intergenic
982143285 4:152352358-152352380 TATCCTCTAATTTTGGTGGGTGG - Intronic
984145420 4:176054367-176054389 TAGACTCTCTGGATAGTGGGTGG + Intergenic
986284796 5:6351240-6351262 ATTCCTCTCAGTAAAGTGGCAGG + Intergenic
988860811 5:35276084-35276106 TATCCTCCAAGGATATTGGGAGG + Intergenic
998236093 5:140400297-140400319 TATCTTGTCAGTAAAGAGGGGGG - Intergenic
999217374 5:149946619-149946641 GAAGCTCACAGTATAGTGGGAGG - Intergenic
999456391 5:151719889-151719911 TATCCTCTCAGAAGAGTTGTCGG + Intergenic
1000323723 5:160156114-160156136 TATAATCTCAGTATTTTGGGAGG + Intergenic
1000403966 5:160866415-160866437 TATCATCACAGTATTTTGGGAGG + Intergenic
1006853484 6:37116363-37116385 TATCATCTCAGTGGAGTGGAAGG + Intergenic
1009659192 6:66588062-66588084 TCTCCTCTCAGTATAGAGGAGGG + Intergenic
1013246409 6:108291317-108291339 TATATCCTCAGTATACTGGGAGG + Intergenic
1016566606 6:145462071-145462093 TTTCCTCTCAGAATAGTGCTTGG + Intergenic
1016965468 6:149714362-149714384 TATCATCCCAGTATTTTGGGAGG - Intronic
1018716634 6:166538147-166538169 TATCCTTTCCATTTAGTGGGTGG + Intronic
1021254796 7:18377674-18377696 TATTCTTTCAGTAAATTGGGTGG + Intronic
1021585399 7:22202332-22202354 TGTCCTCTCAGTATAGGTTGAGG - Intronic
1024445335 7:49471116-49471138 TCTCCACTCAGTAAAATGGGTGG + Intergenic
1027858368 7:83542084-83542106 TATAATCTCAGTATTTTGGGAGG + Intronic
1028888568 7:95961594-95961616 AATCCTCCCTGTATAGTAGGAGG + Intronic
1030281901 7:107784741-107784763 TTTCTTCACAGTTTAGTGGGAGG + Intronic
1030874105 7:114792246-114792268 TCTCCTCTGAGTATCCTGGGGGG - Intergenic
1038102339 8:24392044-24392066 TGTCTTTTCAGAATAGTGGGAGG + Intronic
1041605883 8:59781837-59781859 AATCCTCTAAGTTTAATGGGGGG - Intergenic
1044077455 8:87840238-87840260 TATCCTCTGAGTACACTGGGAGG - Intergenic
1044163332 8:88948523-88948545 TGTCTTCTCAGTATATTTGGGGG + Intergenic
1044944401 8:97377279-97377301 GATTCTTTCAGTATACTGGGAGG + Intergenic
1046855961 8:119032383-119032405 TGTCCTCTCAGTACACTGTGTGG - Intronic
1047280364 8:123440090-123440112 TATAATCTCAGTATTTTGGGAGG - Intronic
1049824771 8:144661640-144661662 TATAGTCTCAGTATTGTGGGAGG - Intergenic
1050862640 9:10454538-10454560 TATCTTTTCAGTAAAGTAGGAGG - Intronic
1190620651 X:52284329-52284351 TCACCTCTCAGCATAGAGGGTGG + Intergenic
1194817788 X:98465472-98465494 TATCCTTTCATTATAGAGAGAGG + Intergenic
1201516888 Y:14827522-14827544 TATCCTCCCAGTACTTTGGGAGG + Intronic