ID: 1126330158

View in Genome Browser
Species Human (GRCh38)
Location 15:47523089-47523111
Sequence CACTGTTAGCAGATGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126330158_1126330164 25 Left 1126330158 15:47523089-47523111 CCATCTTCCATCTGCTAACAGTG 0: 1
1: 0
2: 0
3: 27
4: 231
Right 1126330164 15:47523137-47523159 AAGCCAGAGAGCAAAGTGCTTGG 0: 1
1: 0
2: 3
3: 49
4: 358
1126330158_1126330165 26 Left 1126330158 15:47523089-47523111 CCATCTTCCATCTGCTAACAGTG 0: 1
1: 0
2: 0
3: 27
4: 231
Right 1126330165 15:47523138-47523160 AGCCAGAGAGCAAAGTGCTTGGG 0: 1
1: 0
2: 4
3: 38
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126330158 Original CRISPR CACTGTTAGCAGATGGAAGA TGG (reversed) Intronic
900915902 1:5638390-5638412 GACTCTCAGCTGATGGAAGATGG + Intergenic
901625111 1:10619666-10619688 CACTCTTAGCACATGAAACATGG + Intronic
902689985 1:18105037-18105059 CACAGTTAGCAGAGGGCACAGGG - Intergenic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
903649555 1:24914485-24914507 CCCTGTGAGCAGATGAAAGCCGG + Intronic
905501940 1:38446328-38446350 CCAAGGTAGCAGATGGAAGAAGG - Intergenic
906565462 1:46797957-46797979 CACTAGTAGGAGATGGGAGATGG + Intronic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
909241963 1:73224569-73224591 CAATGTTAGTAGATAGAAGTTGG + Intergenic
909318864 1:74257149-74257171 GATTGTTATCAGATGGGAGATGG - Intronic
910424976 1:87112660-87112682 CACAGCTAGGAGGTGGAAGATGG + Intronic
910625658 1:89303597-89303619 CAGTGCTAGCAGGTGGGAGATGG + Intergenic
911445387 1:97985638-97985660 AACGGTGAGCAGAAGGAAGATGG - Intergenic
912231365 1:107796330-107796352 CACTGATAGGAGTTGGAAGCCGG - Intronic
914675875 1:149906884-149906906 CAGTCATAGCAGATGGGAGAGGG + Intronic
914883552 1:151566426-151566448 CACTGTTAACAGATTGAAGTGGG + Intronic
916853019 1:168723275-168723297 CATGGCTAGCAGATGGCAGACGG - Intronic
918072098 1:181140670-181140692 CAGTGTTCTCAGCTGGAAGATGG + Intergenic
919290101 1:195619225-195619247 CACAGTTCGCAGATTGAACAAGG - Intergenic
919718448 1:200805767-200805789 AACTGGTAGCAGATTGGAGAAGG + Intronic
921305727 1:213794704-213794726 CCCTTTCAGCACATGGAAGACGG + Intergenic
924516338 1:244769072-244769094 CACTGTTAGGAGATTGGGGAGGG + Intergenic
1063426117 10:5951406-5951428 CACTGTGAGCATTTGGGAGATGG - Intronic
1064045910 10:12015269-12015291 AACTTTTAGAAGATGGAAGATGG - Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1065178423 10:23100826-23100848 CACTGTGACAAGATGGAAAAAGG + Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065701422 10:28429617-28429639 CACTGGTAACAGTTTGAAGAAGG - Intergenic
1066981940 10:42424472-42424494 GACTGTTAGCACATGCTAGAGGG - Intergenic
1068461220 10:57331680-57331702 GCCTGTCAGCAGATGAAAGAGGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068872737 10:61962777-61962799 CACTGTTAGTCGATGGATGAAGG - Intronic
1069230381 10:66001846-66001868 TACTGTCAGCAGGTGTAAGAAGG - Intronic
1069937122 10:71925238-71925260 CACTGGCAGAAGATGGAAGCAGG - Intergenic
1070350501 10:75587724-75587746 TACTGTGAGAAGCTGGAAGATGG + Intronic
1070638783 10:78150858-78150880 CACTCACAGCAGTTGGAAGATGG + Intergenic
1071824259 10:89309112-89309134 CAATGGTAGCAGGTGGCAGATGG - Exonic
1072048102 10:91677278-91677300 CACTGCGAGGAAATGGAAGATGG + Intergenic
1074394723 10:113088324-113088346 CACTGCTAGTAAATGGCAGAGGG - Intronic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1081367435 11:42253128-42253150 CACTGTTTAAAGAAGGAAGAAGG + Intergenic
1082759197 11:57109996-57110018 CACTATTGGGAGATAGAAGAGGG - Intergenic
1082779613 11:57276707-57276729 GCCTGCTATCAGATGGAAGAGGG - Intergenic
1083112079 11:60420647-60420669 CACTGTTACCTGGTTGAAGATGG - Intergenic
1083331390 11:61900023-61900045 CACTCTCAGCAGCTGGGAGATGG - Intronic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1085161247 11:74348086-74348108 CGTTATTATCAGATGGAAGAAGG - Intronic
1085562646 11:77486571-77486593 CACTGCCAGGGGATGGAAGAGGG - Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085725901 11:78954251-78954273 CACGTTTAGGAAATGGAAGAAGG + Intronic
1090759918 11:129827352-129827374 CACTGTTAGCAGATGCTGAAGGG + Intronic
1091211192 11:133863093-133863115 CACTGTCAGTAGGTGGAAAAAGG - Intergenic
1091659503 12:2372893-2372915 CAATGGTAGCAGATGGATGCGGG + Intronic
1091697181 12:2635644-2635666 CTCTTTTAGCAGATGGACTATGG + Intronic
1092057470 12:5520016-5520038 CACCGTTTACAGATGAAAGATGG + Intronic
1092815871 12:12311918-12311940 CAATGTTAGAAGATGGAGCAGGG + Intergenic
1092865548 12:12757625-12757647 TACTTTTGGGAGATGGAAGAGGG - Intronic
1096008979 12:48197128-48197150 TACTGTTAACAGTTGGAAGAGGG + Intergenic
1098622342 12:72617593-72617615 GACTGTTAACATAGGGAAGAGGG - Intronic
1098977549 12:76918862-76918884 CACTCTTGGCAAATGTAAGATGG + Intergenic
1100981394 12:100165535-100165557 CACAGTTAGCAGATGGTGGTTGG - Intergenic
1101819445 12:108172666-108172688 AACTGCTAGAAGCTGGAAGAGGG + Intronic
1101997651 12:109536369-109536391 GACTGTCAGCACAGGGAAGATGG + Exonic
1102166363 12:110809979-110810001 CACTTTCAGCAGCTGGAACAGGG - Intergenic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1105611533 13:21973729-21973751 CACTTTTACCAAATGGAATATGG + Intergenic
1106294542 13:28399100-28399122 AACTGTTAGCTGGTGGAAGCTGG + Intronic
1106350228 13:28922688-28922710 CACTGTCAAGAGATGGGAGACGG + Intronic
1107086205 13:36430693-36430715 CACTGTTGGCAGGTGGGGGAGGG + Intergenic
1107089013 13:36456159-36456181 CATAGTTAGCTGATGGAAGGTGG + Intergenic
1107838066 13:44428157-44428179 CACTGGCAGGAGATGGAAGTGGG - Intergenic
1110149310 13:72230259-72230281 CACTGTGAAGAGATGAAAGAGGG + Intergenic
1110309474 13:74031630-74031652 CACTGCTTGTAGATGGAAGAAGG - Intronic
1110323751 13:74189517-74189539 CACAGTTAGCAGAGGGAACAAGG - Intergenic
1116225100 14:42140326-42140348 CACTGTTAGAAGAGGGAACAGGG - Intergenic
1120168560 14:81225958-81225980 CAATGTTAGCAGTTGGGGGATGG - Intergenic
1120867540 14:89308815-89308837 CACTGTGAACAAATGGAAGGAGG + Intronic
1122457496 14:101865593-101865615 CACAGTTAGCAGATTAAAGTTGG - Intronic
1123878542 15:24651168-24651190 TAATGATGGCAGATGGAAGATGG + Intergenic
1124452461 15:29808306-29808328 CACTGTTAGAAGTTGGGACAGGG + Intronic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1126768207 15:52030153-52030175 CACTGCTAAGAGATGGGAGAAGG - Intronic
1128858710 15:71045888-71045910 CACTGTGCACACATGGAAGATGG - Intronic
1128908191 15:71487252-71487274 CTCTGTTTGGAGATGGAAGGTGG + Intronic
1130258364 15:82336356-82336378 CACTCTGAGCAGGTGAAAGAGGG + Intergenic
1130336103 15:82958567-82958589 CTCTGGCAGCAGATGGGAGAAGG + Intronic
1130596563 15:85253604-85253626 CACCCTGAGCAGGTGGAAGAGGG - Intergenic
1132756696 16:1488708-1488730 AATTGGCAGCAGATGGAAGACGG - Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1137572820 16:49577971-49577993 CACTGTGGGCAGGTGGAAGAAGG + Intronic
1138150973 16:54656725-54656747 CACAGTGAGTAGATGGAAGAAGG + Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142525256 17:535751-535773 TAATGTTTGCAGATGGCAGATGG - Intronic
1143387232 17:6538302-6538324 CAGTGTTAGGACATGGAAAATGG - Intronic
1144878581 17:18418229-18418251 CAGTGTTAGCTGCTGGAATAAGG + Intergenic
1144885171 17:18453011-18453033 CAGTGTTAGCTGCTGGAATAAGG - Intergenic
1145058740 17:19719339-19719361 TCATGTCAGCAGATGGAAGAAGG + Intergenic
1145147047 17:20491366-20491388 CAGTGTTAGCTGCTGGAATAAGG + Intergenic
1145153653 17:20526158-20526180 CAGTGTTAGCTGCTGGAATAAGG - Intergenic
1145177115 17:20710455-20710477 CAGTGTTAGCTGCTGGAATAAGG + Intergenic
1145213251 17:21032122-21032144 CACTGTAGGCAGTTGAAAGACGG - Intronic
1145787171 17:27601678-27601700 CACTGCTAGGAGATGGCAGAAGG + Intronic
1147359724 17:39923163-39923185 CACTGGGAGCAGATGGATTATGG - Exonic
1148022256 17:44561189-44561211 CACTGTTAAGAAATGGAAGATGG - Intergenic
1148483653 17:47976674-47976696 GAGTGTTAGCTCATGGAAGATGG - Intronic
1150450353 17:65261411-65261433 CACTGACAGCAGCTGGGAGACGG + Intergenic
1151526425 17:74671998-74672020 CACTGCTAGCAGATGTAACAGGG - Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152157959 17:78647216-78647238 CAATGTCAGCAGATTGAACATGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1160470189 18:79124823-79124845 CACAGTTAGCAGTTGGAGGAAGG + Intronic
1160752851 19:742794-742816 AACTGTCTACAGATGGAAGAAGG - Intronic
1161742387 19:6030579-6030601 GGCTGTCAGGAGATGGAAGAAGG + Intronic
1163102796 19:15107979-15108001 CACTGTTAGTAGGTGGGAGGCGG - Intronic
1167216997 19:48171335-48171357 AACTGTTGGCACATGGAAGGAGG + Intronic
925555731 2:5129978-5130000 GACTGTCAGCAGATGGAGGGAGG - Intergenic
925631560 2:5899062-5899084 CTAGGTTAGCAGATGGGAGAAGG - Intergenic
925870136 2:8263141-8263163 CACAATTAGCAGATGGCAGCTGG - Intergenic
926618062 2:15019443-15019465 CTCTGTTAGCAGGTGGAAAGAGG + Intergenic
927425868 2:22980461-22980483 CCTTGTTAGCAGGTGGTAGAGGG - Intergenic
928464565 2:31511511-31511533 CACTGTTAGCTGAAGAAAAATGG + Intergenic
930806671 2:55497264-55497286 CACAGATAGCAGGAGGAAGAGGG + Intergenic
932449225 2:71798989-71799011 CACTGTTAGTCCATGGGAGAAGG + Intergenic
933878342 2:86643035-86643057 CACTGTCAGAAGAGGGAAAAAGG - Intronic
937135190 2:119545574-119545596 CCCTGTTAGCAGAGGGATGGAGG + Intronic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
937764512 2:125643797-125643819 AAATGCTAGCAGATGGGAGACGG - Intergenic
938195460 2:129323628-129323650 CACTGTAAGCAAAGAGAAGAGGG + Intergenic
939113468 2:138034159-138034181 CACTCATAGCAGATGGGAAATGG - Intergenic
941870223 2:170376649-170376671 CACTGTTACCAGATTCCAGATGG - Intronic
942119834 2:172765797-172765819 CACTGTTGGGAGGTGGAAGTGGG + Intronic
943783986 2:191856367-191856389 TATTGATAGCAGTTGGAAGATGG + Intergenic
944520120 2:200557091-200557113 CACTGTTTGCAGATGGCTGTGGG - Intronic
944938011 2:204589889-204589911 CCCAGTGAGCAGATGGGAGATGG + Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
948467713 2:238160108-238160130 CACTGTCAGCAGGAGGCAGACGG + Intronic
948666991 2:239542311-239542333 CACTGTAAGCACTTGAAAGAAGG + Intergenic
1169510222 20:6255816-6255838 CACTGATAGCAGCTGGGAGCTGG + Intergenic
1170122353 20:12924861-12924883 CACAGTGAGCAAATGGCAGATGG - Intergenic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1177283165 21:19011641-19011663 CAGTGTTAACATTTGGAAGAGGG - Intergenic
1178020148 21:28398540-28398562 CATCTTTAGCAGATGGAAGAGGG - Intergenic
1179873981 21:44258277-44258299 CCCTGGTAGCAGATGGGAGAGGG - Intronic
1179874551 21:44261504-44261526 CCCTGTTACAACATGGAAGATGG + Intronic
1180841429 22:18960635-18960657 CCCTGTGTGCAGATGGCAGATGG - Intergenic
1181060067 22:20278159-20278181 CCCTGTGTGCAGATGGCAGATGG + Intronic
1182779026 22:32852663-32852685 CAGAGTTAGCAGACGGGAGAAGG - Intronic
1184598811 22:45530436-45530458 CACTGGTAGCAGTGGGAGGAAGG - Intronic
949196474 3:1315509-1315531 CATTGTTAGCAGCTGCAAGCTGG + Intronic
949302894 3:2605343-2605365 CAGTGTTAGGAGGTGGGAGAAGG + Intronic
950419775 3:12892040-12892062 CACTGTTAGCAGGTGAGAGTCGG - Intergenic
950507296 3:13403343-13403365 CACTGTTGTCACATGGCAGAAGG + Intronic
950820484 3:15753136-15753158 CACAGTTAGGCTATGGAAGAAGG + Intronic
952760460 3:36908997-36909019 CTCTCTTAGCAGATGGAACAGGG + Intronic
952974807 3:38684711-38684733 CACTGTTACCAAAAGGAGGAAGG - Intergenic
953210406 3:40870210-40870232 CACTCTCAGCAGCTGGGAGATGG + Intergenic
953270805 3:41442151-41442173 GACTGTTAGCTGATGGGAAAGGG + Intronic
955355830 3:58231872-58231894 GAATGTTAACAGATGGCAGAGGG - Intergenic
956371655 3:68570366-68570388 CACTCTTAGCAGATTTCAGAGGG + Intergenic
956530150 3:70209530-70209552 CCCAGTTAGCAGATGAATGAAGG + Intergenic
956745619 3:72308791-72308813 TACTGTGAGCAGATGCAAGGAGG + Intergenic
959965681 3:112351836-112351858 CACTAATAGCAGAAGGAAAAGGG + Intronic
960961798 3:123076036-123076058 TGCTGGTAGCAGAGGGAAGATGG + Intronic
961173942 3:124818733-124818755 CAATGTTAGAAGATGAAACAAGG - Intronic
962488080 3:135864216-135864238 CCTTGGTAGCAGAAGGAAGAGGG - Intergenic
963703771 3:148659912-148659934 GTCTGTTAGCCGTTGGAAGATGG + Intergenic
964834046 3:160917685-160917707 CACTGATAGCAGATTAGAGAAGG + Intronic
966092642 3:176159027-176159049 CATTTGTAGCAGAAGGAAGATGG + Intergenic
966435402 3:179878174-179878196 CCATGATAGAAGATGGAAGAGGG - Intronic
966464242 3:180212333-180212355 CACTTTTAGAAGATGGAAATGGG - Intergenic
969540420 4:7785096-7785118 CACAGTTAGCAGATGAATGAAGG - Intronic
972247876 4:37264919-37264941 CACTATTAGCATATGCTAGAGGG + Intronic
972340092 4:38145007-38145029 CACAGTGACCAAATGGAAGATGG + Intergenic
974529463 4:63089110-63089132 CACTCACAGCAGCTGGAAGATGG + Intergenic
974840100 4:67289446-67289468 CGCTGCTAACAGATGGAAGGAGG + Intergenic
975485316 4:74928843-74928865 CTCAGTTAGTAGATGGCAGAGGG + Intergenic
976384765 4:84443938-84443960 TTTTGTTGGCAGATGGAAGAGGG + Intergenic
977077865 4:92480844-92480866 CACAGGTAGCAGATGAAATAGGG - Intronic
977942578 4:102874929-102874951 CTCTGGTATCAGATGGAAGATGG - Intronic
978896519 4:113895103-113895125 CAGTGGTTGCAGATGGAAGTTGG - Intergenic
980076611 4:128300526-128300548 CACTGTTAGCCCATGAAAGAAGG + Intergenic
980517706 4:133886155-133886177 CACTTTTAGTTGTTGGAAGATGG - Intergenic
980899458 4:138890679-138890701 CTCTGCTACCAGATGGATGATGG + Intergenic
981298248 4:143157124-143157146 CACTGCCAGGAGATGGAAAAGGG + Intergenic
983178069 4:164615036-164615058 CACTGTAAGCAACTGGAGGATGG - Intergenic
984385801 4:179056052-179056074 CACTGTTCTCACATGGCAGAAGG - Intergenic
989306215 5:39959763-39959785 CAATGATAGCAGAAGGATGAAGG - Intergenic
992602426 5:78415963-78415985 CAGTGTTAGGAGGTAGAAGATGG + Intronic
996016391 5:118538611-118538633 CTCACTTTGCAGATGGAAGACGG - Intergenic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
998175665 5:139900615-139900637 GACTGTTACTATATGGAAGAGGG - Intronic
1001136782 5:169109046-169109068 CACTGACAGCATATGGAAAAGGG + Intronic
1003334348 6:5156468-5156490 CACTGGTAGCAGAAAGAATAAGG + Intronic
1003452926 6:6253378-6253400 CAATGTTAGCAGAAGCAAGTAGG + Intronic
1005136795 6:22578157-22578179 CCATTTTAGCAGATGGAAAAAGG + Intergenic
1005316105 6:24604268-24604290 CAATGGCTGCAGATGGAAGATGG - Intronic
1005775218 6:29124028-29124050 CACTATTAGCACATGAAAAATGG - Intergenic
1005781281 6:29195264-29195286 CACTATTAGCACATGAAAAATGG - Intergenic
1006046133 6:31300335-31300357 CCTTGTTAGCAGATGGGAGAGGG - Intronic
1006925697 6:37654089-37654111 AACTGCCAGCAGATGGCAGAAGG - Intronic
1012026970 6:94008304-94008326 CACTGTTGGTGGATGGGAGAGGG - Intergenic
1012271642 6:97219653-97219675 CACTGTTGGTAAATGAAAGAGGG + Intronic
1012757242 6:103247802-103247824 CACTGTTATAAGATTGAAAACGG + Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016761049 6:147738094-147738116 AAATGCTAGCAGATGGGAGATGG + Intergenic
1017022709 6:150153036-150153058 CACAGCAAGAAGATGGAAGACGG + Intronic
1017146014 6:151235737-151235759 CACTGTTAGAAGATACCAGAAGG - Intergenic
1018223757 6:161607861-161607883 CACAGTGAGCAAATGGATGATGG + Intronic
1018423269 6:163658443-163658465 CACTGTCAGCAGCAGGGAGAAGG - Intergenic
1023362763 7:39432708-39432730 CACTCTTCCCAGGTGGAAGAGGG + Intronic
1024675341 7:51633098-51633120 CACTGTTAGCAGATGCTTCAAGG + Intergenic
1027630303 7:80596057-80596079 AACTGTTAGAAATTGGAAGATGG + Intronic
1033305530 7:140222827-140222849 CCCTGTTCGCAGAGGGAACACGG + Intergenic
1034476109 7:151283277-151283299 CCATATTAACAGATGGAAGAAGG + Intergenic
1036484056 8:9163852-9163874 CTCAGTGAGCAGATGAAAGAGGG + Intronic
1038452187 8:27646827-27646849 AACTGTTGGCAGATTGACGATGG + Intronic
1039122465 8:34162741-34162763 TACTCTTAGCAGGTGGGAGAGGG - Intergenic
1040621987 8:49101611-49101633 CACTTGTAGGAGGTGGAAGAGGG - Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041305124 8:56449615-56449637 CATTATTTTCAGATGGAAGATGG + Intergenic
1042678317 8:71348487-71348509 CACTATTAGCAATTGGAAGTAGG + Intronic
1042701179 8:71616747-71616769 CAGTGTCAGCAAATGGAACAAGG + Intergenic
1043150683 8:76712041-76712063 CACTACTAGCAGATGCAGGAAGG - Intronic
1045236874 8:100359749-100359771 CACAGTTAGGAGGTGGAAGAAGG + Intronic
1048171091 8:132107257-132107279 TACTCTTAGTAAATGGAAGAGGG - Intronic
1048349237 8:133602611-133602633 CAGTGATAGCAGAAAGAAGAGGG + Intergenic
1048564765 8:135584013-135584035 CTTTGGTAGCAGATGGAAAAGGG - Intronic
1050377725 9:4990376-4990398 CAGTGTTAGTAGCTGGTAGAGGG + Intronic
1050901529 9:10954811-10954833 GACTGTTTGCATGTGGAAGAAGG - Intergenic
1051039229 9:12785728-12785750 CACTGCTAGGAGATGGAGGAGGG + Intronic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1052168519 9:25364196-25364218 CCCTTTTAGCAGAAGAAAGATGG - Intergenic
1052897480 9:33761255-33761277 CACTGTTAGCAGATGCTGAAGGG + Intronic
1053218476 9:36292429-36292451 CAATGTTAGGAGAAGGATGAAGG - Intronic
1055726896 9:79240184-79240206 AACTTTTAGTAGAAGGAAGAAGG + Intergenic
1055959164 9:81803698-81803720 CACTGTTACCACATGGCAGAAGG + Intergenic
1058358986 9:104119765-104119787 CAGTGTCAGACGATGGAAGATGG + Intronic
1059736526 9:117105460-117105482 CACGGGTAACAGATGGCAGAGGG - Intronic
1060062518 9:120473835-120473857 CCCTGTCAGAAAATGGAAGAGGG - Intronic
1062080246 9:134619940-134619962 CACTGTGGGCCGATGGGAGAAGG + Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1187112033 X:16312285-16312307 CAATGTTGGGAGATGGGAGAGGG + Intergenic
1187396635 X:18924885-18924907 CACTGTGAGCAGGTGGGAGGTGG + Intronic
1187974574 X:24692423-24692445 CTCTGTTCTCACATGGAAGAAGG + Intergenic
1188316304 X:28678081-28678103 GAATGCTAGCAGATGGGAGATGG + Intronic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190685846 X:52872425-52872447 CACTCTTATCAGATGGAGAATGG - Intergenic
1191001286 X:55662350-55662372 CACTCTTATCAGATGGATAATGG - Intergenic
1192890802 X:75388991-75389013 CACTGCTAGGAGATGGGAGAGGG - Intronic
1193635413 X:83944090-83944112 CACTGTGAGCAGATGCAACAAGG + Intergenic
1193924043 X:87464066-87464088 CATTGTGGGCAGATGGGAGAGGG + Intergenic
1194877670 X:99209060-99209082 CACTGTTGGGGGATGGAGGAGGG + Intergenic
1194964960 X:100277775-100277797 TACTTTTAGCAGATGGAAGTGGG - Intergenic
1198649262 X:138843227-138843249 CTCTGTAGGTAGATGGAAGAAGG - Intronic
1199334441 X:146601427-146601449 CACTGCTGAGAGATGGAAGAGGG + Intergenic
1199860253 X:151795014-151795036 ATCTGTTAGGAGATGGGAGAAGG - Intergenic