ID: 1126330720

View in Genome Browser
Species Human (GRCh38)
Location 15:47528105-47528127
Sequence GACTCAGGATTACATCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126330720_1126330722 -1 Left 1126330720 15:47528105-47528127 CCTGGTTGATGTAATCCTGAGTC 0: 1
1: 0
2: 2
3: 3
4: 80
Right 1126330722 15:47528127-47528149 CTCTGTTTTAAACTTTAATGTGG 0: 1
1: 0
2: 0
3: 35
4: 375
1126330720_1126330723 28 Left 1126330720 15:47528105-47528127 CCTGGTTGATGTAATCCTGAGTC 0: 1
1: 0
2: 2
3: 3
4: 80
Right 1126330723 15:47528156-47528178 CATTCATTTTTAGCTGAATAAGG 0: 1
1: 1
2: 2
3: 16
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126330720 Original CRISPR GACTCAGGATTACATCAACC AGG (reversed) Intronic
903319904 1:22536684-22536706 GACCCAGCATTACATCCACTTGG + Intergenic
904590849 1:31614646-31614668 GGCTCAGGATTAGATCAACAAGG + Intergenic
906180057 1:43810399-43810421 GACTCACGATTCCAACCACCCGG - Intronic
914800915 1:150961880-150961902 CGAGCAGGATTACATCAACCAGG - Intronic
917691735 1:177476923-177476945 GACTCAGGGATATAGCAACCTGG + Intergenic
918051238 1:180974228-180974250 GACACAGGATCAAATCAGCCAGG + Exonic
918085924 1:181245168-181245190 GACTCAGAAACACATGAACCAGG + Intergenic
1062811918 10:472843-472865 GAGTCAGGATTAGAGCAACAGGG + Intronic
1068753233 10:60620543-60620565 GACTCTGGAGTCCCTCAACCTGG - Intronic
1073736922 10:106358951-106358973 GACCCAGGATTACATGAATGTGG - Intergenic
1073851195 10:107620198-107620220 GACTCAGGAATAACACAACCTGG + Intergenic
1074752457 10:116599821-116599843 GACTGAGGATTACATGGACAAGG + Intronic
1077916638 11:6615861-6615883 GAGACAGGAGTACAGCAACCAGG + Intronic
1090475237 11:127014210-127014232 GGCTCAGGATTAAATCAAAAGGG + Intergenic
1091573041 12:1707516-1707538 GAGCCAGGATCACATCAACCTGG - Intronic
1093436793 12:19144519-19144541 GACTTTGACTTACATCAACCAGG - Intronic
1094039779 12:26110620-26110642 GACTCGGGATTTCAGGAACCAGG - Intergenic
1106030496 13:25998060-25998082 GAATCTGGATTACCTCTACCCGG - Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1108564668 13:51683895-51683917 TACTCAGGTTTCCACCAACCTGG - Intronic
1109787384 13:67196398-67196420 GACTCAGGAGTAAAACATCCTGG - Intronic
1111642319 13:90984163-90984185 TACTCAGGTTTACAGCAAACTGG - Intergenic
1111908205 13:94280373-94280395 GACTGAGGAGTACATAAGCCAGG - Intronic
1114188567 14:20422795-20422817 GTCTCAGGAGTACATCAGGCTGG + Intergenic
1117160276 14:52982853-52982875 AACTCAGCATCACATCAGCCAGG + Intergenic
1117749417 14:58904406-58904428 AACTCAGGGTAACTTCAACCTGG + Intergenic
1118168090 14:63357698-63357720 GACTAAGGATTACATCAATCTGG + Intergenic
1120511116 14:85415518-85415540 GACTCTGGATGAGATCACCCAGG + Intergenic
1120704046 14:87729111-87729133 GCCTCAGAATGAAATCAACCTGG + Intergenic
1122050289 14:99054632-99054654 GCCTAAGGAATACAGCAACCAGG - Intergenic
1126330720 15:47528105-47528127 GACTCAGGATTACATCAACCAGG - Intronic
1129371995 15:75103080-75103102 GGATCAGGATCACATCAGCCAGG - Intronic
1129477906 15:75798824-75798846 TACTCAGGATTGCTTGAACCAGG + Intergenic
1131372233 15:91892232-91892254 GCCTCAGGGTTAGATCTACCAGG - Intronic
1137497799 16:48984155-48984177 GAATCAGGATGCCATAAACCAGG + Intergenic
1138049338 16:53760094-53760116 GGCTCAGGAATACAATAACCAGG - Intronic
1141131209 16:81438292-81438314 GTCTCAAAATTACATCAGCCAGG - Intergenic
1146852827 17:36238201-36238223 GACACAGGATTTCATCATCTTGG - Intronic
1146868738 17:36362093-36362115 GACACAGGATTTCATCATCTTGG - Intronic
1147071613 17:37962717-37962739 GACACAGGATTTCATCATCTTGG - Intergenic
1147083139 17:38042241-38042263 GACACAGGATTTCATCATCTTGG - Intronic
1147099082 17:38166214-38166236 GACACAGGATTTCATCATCTTGG - Intergenic
1150082098 17:62249526-62249548 GACACAGGATTTCATCATCTTGG - Intergenic
1150918693 17:69461259-69461281 CACCCAGGAGTACATAAACCAGG - Intronic
1158254771 18:55533431-55533453 CTCTCAGGATAACATTAACCAGG - Intronic
1158869416 18:61670188-61670210 GTCTCAAGATGACATCATCCTGG - Intergenic
1162991857 19:14308124-14308146 GCCTCATGATACCATCAACCAGG - Intergenic
1167579720 19:50334306-50334328 GGCCCAGGATTACGTCATCCAGG - Intronic
1167836700 19:52078191-52078213 GACACAGAATTACTTGAACCTGG + Intronic
925700532 2:6632830-6632852 GACTCTGGACTAAATTAACCAGG + Intergenic
925707586 2:6701744-6701766 GACAGAGGATGGCATCAACCTGG - Intergenic
940780571 2:157929400-157929422 TACTCAGAATCACTTCAACCTGG - Intronic
941001275 2:160205763-160205785 GACTCAGGATTTCCTCTCCCAGG - Intronic
942226869 2:173824074-173824096 GAGTCTGGAATATATCAACCAGG + Intergenic
946933093 2:224690730-224690752 GAGGCAGGATTACTTGAACCTGG + Intergenic
1171376692 20:24698820-24698842 GACTCAGGATCCCAGCAACCTGG - Intergenic
1173102607 20:40101022-40101044 AACTCAGGATTAAATAGACCTGG + Intergenic
1174406590 20:50306887-50306909 GACTCAGCCTTACATGAACTGGG - Intergenic
1176137566 20:63530826-63530848 GTCGCAGAATTACATCCACCGGG - Exonic
1180055292 21:45355624-45355646 GTCTCAGGCTTACATCCGCCTGG - Intergenic
1183193866 22:36339800-36339822 GAGTCAGGATTACATATGCCAGG + Intronic
950964500 3:17136942-17136964 GAGCCAGGATTCCAACAACCGGG - Intergenic
959334755 3:105050026-105050048 GAGACAGGATTTCACCAACCTGG + Intergenic
960698238 3:120416231-120416253 GACTCAGAAGTACCTGAACCTGG - Intronic
961570890 3:127797985-127798007 TGCTCTGGATGACATCAACCTGG - Intronic
962601911 3:136997865-136997887 GAGTCAGGATTCCTTAAACCCGG - Intronic
967589270 3:191253546-191253568 GACTCAGCATGACCACAACCAGG + Intronic
969150422 4:5164417-5164439 ATCTCAGGATGAGATCAACCTGG - Intronic
990704733 5:58515431-58515453 GACTCAGCATTACAGCCTCCTGG + Intergenic
992087925 5:73294651-73294673 GACTCAGGATTACAACAATCTGG + Intergenic
996982253 5:129512939-129512961 GGCTTCGGATTATATCAACCTGG - Intronic
999212153 5:149899259-149899281 GAGTCAGGGTTATAGCAACCAGG + Intronic
999729671 5:154467405-154467427 AACTCAGGATCCCAGCAACCTGG + Intergenic
1001824419 5:174733844-174733866 GACTCAGGATTCCTGCAGCCGGG - Intergenic
1016847028 6:148578702-148578724 GACTCAGGATTAGGTCCACATGG - Intergenic
1026372652 7:69717169-69717191 GATTCAGGCTTACATCAAAATGG + Intronic
1027683315 7:81247794-81247816 TACACATGATTACATCATCCAGG - Intergenic
1029184768 7:98730605-98730627 GAGTCAGGATGACATCAATATGG + Intergenic
1032724587 7:134578946-134578968 GACTCAGAAGTAAATCCACCTGG + Intronic
1042940998 8:74107740-74107762 GACTTAGGATTCAATCATCCAGG + Intergenic
1050077536 9:1880701-1880723 GATTCAGCAGTACATCAAACGGG + Intergenic
1054893017 9:70272501-70272523 AACTCAGGAATTCACCAACCTGG + Intronic
1059802728 9:117766764-117766786 GACTCTAAATTAAATCAACCTGG - Intergenic
1059832367 9:118111831-118111853 GACTCTGATTTACATGAACCTGG + Intergenic
1189154637 X:38744858-38744880 GAGTAAGGATTCCATCACCCTGG - Intergenic
1190581960 X:51898387-51898409 GTCCCAGGATTGCATTAACCTGG + Intronic