ID: 1126333796

View in Genome Browser
Species Human (GRCh38)
Location 15:47564656-47564678
Sequence AATTCTAGGGAGAAAAGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 2, 1: 25, 2: 71, 3: 174, 4: 487}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126333788_1126333796 8 Left 1126333788 15:47564625-47564647 CCTAGATACTGATAGGGACAGGA 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1126333796 15:47564656-47564678 AATTCTAGGGAGAAAAGGGCGGG 0: 2
1: 25
2: 71
3: 174
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126333796 Original CRISPR AATTCTAGGGAGAAAAGGGC GGG Intronic
900974909 1:6010933-6010955 AATTCTAAGGAGGAAAGAGCTGG - Intronic
901549986 1:9989007-9989029 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
903280733 1:22248474-22248496 GATTCTAGGGACAGAGGGGCTGG + Intergenic
903601614 1:24546236-24546258 AATTCTAGGCTGAAAAGGACAGG + Intergenic
904222554 1:28984322-28984344 AATTCTAGGCAGAAAAGGACGGG - Intronic
904513544 1:31034905-31034927 AATACCAGTGAGAAAATGGCAGG + Intronic
905183936 1:36182866-36182888 AATTCCAGGGACAAAGGAGCAGG + Intergenic
905191133 1:36235852-36235874 AATGCTAGGTAGAAAAGAGATGG + Intronic
905299094 1:36973876-36973898 AATTCAGGTGAGACAAGGGCAGG - Intronic
905350640 1:37344097-37344119 AGGCCTGGGGAGAAAAGGGCTGG - Intergenic
906802769 1:48751841-48751863 GAGTCTAGGGAGAAAGGGGAAGG + Intronic
907021851 1:51074058-51074080 AATTCTAGGGGGAAAAAGCAGGG - Intergenic
908249085 1:62251097-62251119 TCTTCTTTGGAGAAAAGGGCAGG + Intronic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
909185667 1:72482218-72482240 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
909570590 1:77105437-77105459 AATTCTAGGCAGATAGGGGTGGG - Intronic
909775454 1:79479037-79479059 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
909961354 1:81847681-81847703 AATATTAGGGAGAAAGGGTCAGG - Intronic
910023088 1:82616683-82616705 ATTTCAAGGGAGAAAAGGAGAGG - Intergenic
910139270 1:84008809-84008831 ATTCTAAGGGAGAAAAGGGCAGG + Intergenic
910150303 1:84134354-84134376 AATTCTAGGCAGAAAAGGGCAGG - Intronic
910243136 1:85109904-85109926 AATTTGAGGGAGGAAAGGGAAGG + Intronic
910440101 1:87243002-87243024 AATTCTGAAGAGGAAAGGGCAGG - Intergenic
911205774 1:95090357-95090379 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
911546678 1:99225375-99225397 AATACTTGGTAGAAGAGGGCGGG - Intergenic
911559929 1:99392735-99392757 GATTCTAGGTATAAAAAGGCGGG - Intergenic
912255251 1:108051903-108051925 CACTCTAGGGAGAAAAAGGGAGG - Intergenic
912582028 1:110729633-110729655 AATTCTAGGCAGAAAAAGATGGG + Intergenic
912963584 1:114217402-114217424 AATTGTAGTGAGAAAACAGCAGG - Intergenic
913097623 1:115534546-115534568 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
913586403 1:120279148-120279170 GATGCTATGGAGAAAAGGGCAGG + Intergenic
913621783 1:120619222-120619244 GATGCTATGGAGAAAAGGGCAGG - Intergenic
914424494 1:147562547-147562569 AATTCTAGGGAGAAATGATAAGG + Intronic
914568412 1:148891010-148891032 GATGCTATGGAGAAAAGGGCAGG + Intronic
914604413 1:149239241-149239263 GATGCTATGGAGAAAAGGGCAGG - Intergenic
915498918 1:156301009-156301031 AATCCTAGGCAGACAGGGGCAGG + Intergenic
915638213 1:157200987-157201009 AATTCTAGGGAGAAAGGGCATGG - Intergenic
916280977 1:163050960-163050982 AACTTTTGGGAGAAAAAGGCAGG - Intergenic
916293759 1:163194117-163194139 AATTCTATGAAGAAAAAGGGTGG - Intronic
916314419 1:163433009-163433031 AATTACAGGGAGAATAGGACTGG - Intergenic
916693042 1:167209444-167209466 AGTTCTAGGGACAATTGGGCTGG + Intergenic
917210960 1:172631764-172631786 AATACTAGGCAGAAAAGGGTGGG + Intergenic
917371926 1:174301991-174302013 AATCCTAGGCAGACAGGGGCAGG - Intronic
917641378 1:176986069-176986091 GCTTCTAGGGACAAAAGAGCAGG - Intronic
918562180 1:185881631-185881653 AATTCTAGGCAGAAAAGGGTAGG - Intronic
918792548 1:188847422-188847444 AATTCTAGGCAGACAGGGGCGGG - Intergenic
918910510 1:190562629-190562651 AATTCTAGGCAGACAAGAGCAGG + Intergenic
919240782 1:194914037-194914059 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
920044501 1:203124722-203124744 AGTTCCAGGGAGAAAAGAGCAGG + Intronic
921030001 1:211328087-211328109 AATTTTAGGCAGCAAAAGGCTGG + Intronic
921154942 1:212432274-212432296 AATACTAGGGAGAAAAAGTAGGG - Intergenic
921679970 1:218020109-218020131 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
922246016 1:223798377-223798399 AAGGCTGGGGAGTAAAGGGCCGG + Exonic
922876400 1:228943056-228943078 AATTCTGGGCAGAAAAGGGTGGG + Intergenic
922992162 1:229923465-229923487 AAGACTAGGGAGGAAAGGGAGGG - Intergenic
923306535 1:232693917-232693939 AATTCTGGGCAGAAGAGAGCGGG + Intergenic
923328139 1:232898603-232898625 GTTTCTGGGCAGAAAAGGGCAGG + Intergenic
923358678 1:233186050-233186072 ACTTCTAAGGAGAAAAATGCTGG - Intronic
923397736 1:233583852-233583874 AATTCTAGGCAGGAAAGGGCAGG + Intergenic
923443163 1:234040469-234040491 AACTCTAGGCAGACAGGGGCGGG - Intronic
923892883 1:238235324-238235346 AATTCTAGGTAGAAAAGGGCGGG - Intergenic
923911041 1:238444564-238444586 TATTCCAGGCAGAAAAGGGCAGG + Intergenic
923944327 1:238865313-238865335 GATTCTAGGCAGAAAAGGGTGGG - Intergenic
924328106 1:242915843-242915865 AGTTCTATGGAAAAATGGGCTGG - Intergenic
924458078 1:244234117-244234139 AATTCTAGGGACAGAGGGGGTGG - Intergenic
924818416 1:247463376-247463398 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
924947267 1:248855042-248855064 AGTTCTAGAGTGAAACGGGCTGG - Intronic
1064101235 10:12466159-12466181 AATTTTAGGGAGACCAAGGCGGG + Intronic
1064399093 10:15005918-15005940 GATGCTAGGAAGAAAAGGGGTGG - Intergenic
1064680499 10:17806756-17806778 AGTGCTAGGTAGAGAAGGGCAGG - Intergenic
1064785215 10:18887661-18887683 AATACTGGGTAGAAGAGGGCGGG + Intergenic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1065979473 10:30878073-30878095 AATTCTAGGCAGACAGGGGCGGG + Intronic
1066281612 10:33923488-33923510 AATTCTAGGCAAAAGAGGGCGGG + Intergenic
1066317797 10:34265898-34265920 AATTCAACAGAGAAAAGGGATGG + Intronic
1066625183 10:37398730-37398752 AATTCTGGGGATACATGGGCAGG + Intergenic
1067266343 10:44748618-44748640 AATTCTAGGCAGACATGGGTGGG - Intergenic
1067879167 10:50029008-50029030 AATCCCATGGAGAAAAGGCCCGG + Intergenic
1068022800 10:51605365-51605387 AGTGCTAGGTAGAGAAGGGCAGG - Intronic
1068178136 10:53487844-53487866 AATTCTAGCCAGAAAAGTGTGGG - Intergenic
1068665981 10:59676557-59676579 AATTTTAGGGAAAAAAGGGGGGG + Intronic
1068681224 10:59822738-59822760 AATTCTAGGCAGAAAAGGGTAGG + Intronic
1069198211 10:65581160-65581182 AATCCTAGGCAGACAGGGGCAGG + Intergenic
1069494962 10:68895465-68895487 ATTTCTAGGGAGAAAAATGCAGG - Intergenic
1069795788 10:71050923-71050945 AATTTTGGGGAGAAAACTGCAGG - Intergenic
1070420227 10:76229086-76229108 AATTCTAAGGAGAATGGAGCTGG + Intronic
1071068916 10:81669352-81669374 AATCCTAGGCAGACAGGGGCAGG + Intergenic
1071152644 10:82652742-82652764 AATTCTAGGCAGACAGGGGTGGG - Intronic
1071410978 10:85394979-85395001 CTTTCTAGGGAGAGAAGGGCAGG - Intergenic
1071423840 10:85528548-85528570 AATTGTGGAGAGAAAGGGGCTGG + Intergenic
1071428500 10:85583273-85583295 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1071674915 10:87646497-87646519 ACTTTTAGGCAGAAAAGGGGAGG + Intergenic
1072208695 10:93226560-93226582 AATTCTAGGCAGACAGAGGCAGG - Intergenic
1073539321 10:104305641-104305663 AATCCTTGGGAGGAAATGGCAGG - Intergenic
1073991616 10:109268158-109268180 TATTCTAGTGAGAAATGAGCAGG + Intergenic
1076081345 10:127584342-127584364 AATTCTAGGTACTAAAGGACTGG - Intergenic
1077661465 11:4072207-4072229 ATCTCTAGGGGGAAAAGGGGAGG - Intronic
1077778494 11:5298148-5298170 AATTTTAGGCAGAAAAGGGCGGG - Intronic
1078470505 11:11582273-11582295 GAGTGGAGGGAGAAAAGGGCAGG + Intronic
1078555087 11:12318540-12318562 AATTTTAAGGAGGAAAAGGCAGG + Intronic
1079344722 11:19641919-19641941 AATTTTAGGTAGAAATGGGAGGG - Intronic
1079512618 11:21228895-21228917 AAATCTAGGGAATAAAGGCCAGG - Intronic
1079573705 11:21976669-21976691 AATTCTAGGCAGAGAGGGGTGGG - Intergenic
1079939114 11:26655914-26655936 AATTATTGGGAGAAAACGGCAGG + Intronic
1080139697 11:28901801-28901823 TATGCTTGGTAGAAAAGGGCAGG - Intergenic
1080604467 11:33853256-33853278 AATTCTAGGCAGACAGGGGTGGG - Intergenic
1081022829 11:37968542-37968564 AATTCTAGGCAGACACGAGCGGG - Intergenic
1081332990 11:41826822-41826844 AATTCAAGGCAGAAAAGGGCAGG - Intergenic
1081338339 11:41896021-41896043 AATCCTAGCGAGAAAAAGGAAGG + Intergenic
1082181487 11:49125595-49125617 ATTTCTAAGGAGAAAATGTCTGG + Intergenic
1082645597 11:55720484-55720506 AATTCTAGGCAGACAAGGGCAGG - Intergenic
1083169326 11:60913558-60913580 AATGCTAGGTAGAAAAGAGCGGG - Intergenic
1084430846 11:69110320-69110342 AGTTCTAGGGAGAGAAAGGCAGG + Intergenic
1085061838 11:73454523-73454545 AATTCTTAGCAGAAAAGAGCAGG + Intronic
1085148002 11:74220749-74220771 TATTCTAGTGAGAAAATGGTTGG + Intronic
1085870832 11:80347344-80347366 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1085946970 11:81284163-81284185 AATACTAGGTAGAAAAGTGCGGG + Intergenic
1086684007 11:89709250-89709272 ATTTCTAAGGAGAAAATGTCTGG - Intergenic
1086783003 11:90930623-90930645 AATTCTAGACAGAAAAAGGCAGG + Intergenic
1087005471 11:93466714-93466736 AATTCTAGGCAAGAAAGGGCGGG + Intergenic
1087608482 11:100405726-100405748 AATTCTACGTAGAAAAGGGCAGG - Intergenic
1087698728 11:101412056-101412078 AATACTAGGCAGAAAAGGGGAGG + Intergenic
1088715383 11:112544272-112544294 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1089913603 11:122128757-122128779 AATTCTCAGGAGAGAAGGTCAGG + Intergenic
1091030144 11:132179326-132179348 AATCCTAGGGAGAGAGGGGCAGG + Intronic
1091041760 11:132287513-132287535 AATTCTTGGGGGAAAAGATCTGG + Intronic
1091834316 12:3574866-3574888 GAGTCCAGGGAGAAAAGAGCAGG + Intronic
1092086478 12:5767134-5767156 AAGTCCAGGGAGGAAGGGGCAGG - Intronic
1092680129 12:10969452-10969474 AATTCTAGACAGAAAAGGGCGGG - Intronic
1092850885 12:12625231-12625253 AATTCTAGACAGAAAAGGGTGGG - Intronic
1093268437 12:17027931-17027953 AATTCTAGACAGAAGAGGGCAGG + Intergenic
1093370363 12:18356981-18357003 AATACTAGACAGAAAAGGGTGGG - Intronic
1093401772 12:18754483-18754505 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1093731291 12:22568458-22568480 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1093755861 12:22851085-22851107 AACTCTAGGCAGACAGGGGCAGG - Intergenic
1093937814 12:25019750-25019772 AACACTAGGTAGAAAAGGGCAGG - Intergenic
1094412541 12:30182570-30182592 AATACTTGGTAGAAAAGGGTGGG + Intergenic
1094634281 12:32209547-32209569 ACTTGTAGGAAGAAAAGGGTTGG - Intronic
1094720709 12:33060629-33060651 TTTTCTAGGGAGAAAAGGTAGGG + Intergenic
1094788251 12:33876662-33876684 ACCTCTAGGAAGAAAAGGGATGG + Intergenic
1095386636 12:41658871-41658893 AATACTTAGGATAAAAGGGCAGG + Intergenic
1096170285 12:49463003-49463025 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1097352447 12:58563019-58563041 AATGCTGGGTAGACAAGGGCAGG - Intronic
1098936837 12:76490226-76490248 AATTCTAGGCAGAAAACGGCAGG + Intronic
1099001984 12:77188928-77188950 AATCCCAGGGAGAAAATGCCAGG - Intergenic
1099540828 12:83905155-83905177 AATTGTAGGCAGAAAAGGGCAGG - Intergenic
1099543803 12:83950724-83950746 AATTCTGGACAGAAGAGGGCGGG + Intergenic
1099550010 12:84032616-84032638 ATTTCTAGGCAGAAAGGGGTGGG + Intergenic
1100293007 12:93235436-93235458 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1100573678 12:95868403-95868425 AATTCTTGGGAGGAGAGGACAGG + Intronic
1100594629 12:96061248-96061270 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1100625609 12:96328248-96328270 AGTTGTAGGAAGACAAGGGCAGG + Intronic
1100757988 12:97773361-97773383 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1101148820 12:101866300-101866322 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1101217399 12:102597600-102597622 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1101377628 12:104184498-104184520 AATACGAGGTAGAAAAGGGTGGG - Intergenic
1101432771 12:104640818-104640840 AATTCTGGGCAGAAGAGGGTTGG + Intronic
1101609772 12:106279807-106279829 AATTCTAGGGGGACAGGGGTGGG - Intronic
1101901922 12:108797362-108797384 AATTCTAGGCAGACAGGTGCGGG + Intronic
1102483923 12:113243391-113243413 AATTTTGGGGAGAAAAAGGGAGG - Intronic
1103817898 12:123673178-123673200 AATTCTGGAGAGAAAAGGACAGG + Intronic
1104219303 12:126766754-126766776 AATCCTAGGCAGACAAGGGCGGG + Intergenic
1104265780 12:127231445-127231467 AATTCTGGGCAGAAAAGGGCAGG + Intergenic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1105639683 13:22249648-22249670 AATTCTGGGCAGAAGAGGGTAGG + Intergenic
1105893701 13:24700307-24700329 ATTTCTAGGGAAAAAAGGGAGGG - Intronic
1106870182 13:34011164-34011186 AATTCTAGGGAGAAAAGGGCGGG + Intergenic
1107217217 13:37935229-37935251 AATTCCAGGCAGAAAACGGCAGG - Intergenic
1107854092 13:44597644-44597666 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1108017028 13:46086683-46086705 GATCCTAGGCAGAAAAGGGCGGG - Intronic
1108248550 13:48542118-48542140 AATTCTAGGCGAAGAAGGGCAGG + Intergenic
1108316505 13:49242355-49242377 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1108487635 13:50942970-50942992 AATTCTGGGCAGAAGAGGGCCGG - Intronic
1108931422 13:55827357-55827379 AATTGAAGGGAGAAATAGGCAGG + Intergenic
1108942610 13:55976849-55976871 ATTCCTAGGCAGACAAGGGCTGG + Intergenic
1108945203 13:56014586-56014608 AATTCTAGGCAGACAAGGGTAGG + Intergenic
1109039226 13:57310669-57310691 AATTCTAGGCAGACAGGGTCGGG + Intergenic
1109419975 13:62099608-62099630 AATTCTAGGCAGAAAAGGATGGG + Intergenic
1109593778 13:64522953-64522975 AATCCTAGGCAGACAAGGGCAGG - Intergenic
1109693824 13:65927607-65927629 AATTCTAGGCAGAAAAGTGCAGG - Intergenic
1109705847 13:66092146-66092168 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1109832844 13:67814597-67814619 AGTTGTAGGGAGAAAAAGGAAGG + Intergenic
1109881029 13:68476603-68476625 AATCCAAGGGAGCAAAGGGTGGG + Intergenic
1109881279 13:68480568-68480590 TATTGTAGGGAGAAAAGGGTGGG - Intergenic
1109882983 13:68506596-68506618 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1109927670 13:69167696-69167718 AATTCTAGGCCGAAAAGGGTGGG + Intergenic
1110159040 13:72353130-72353152 AATTCTAGGCAGAAAAAGGTAGG - Intergenic
1110755641 13:79171123-79171145 CAATTTAGGGAGATAAGGGCAGG + Intergenic
1110938261 13:81318964-81318986 AACTCTAGGCAGACAGGGGCAGG + Intergenic
1111104718 13:83629934-83629956 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1111558435 13:89911185-89911207 AATTCTAGGCAGACAAGGTTGGG - Intergenic
1111606474 13:90546061-90546083 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1112296608 13:98193005-98193027 AATTATTGGAAGACAAGGGCTGG - Intronic
1112333095 13:98492013-98492035 AACTATAGGCAGAAAAGGGTGGG + Intronic
1112611444 13:100958834-100958856 AATGCTTGAGAGAAAATGGCAGG - Intergenic
1113391395 13:109900743-109900765 AATTCCAAGGAGGAAAGTGCTGG + Intergenic
1113467856 13:110524757-110524779 GATTCTGGGCAGATAAGGGCAGG - Intronic
1113559070 13:111263270-111263292 AATTCTTGGGAGAATTGGTCTGG + Intronic
1113937542 13:114002317-114002339 TGTTCAAGAGAGAAAAGGGCGGG + Intronic
1115979445 14:39033658-39033680 AATGCCAGGGAGAAAGGGTCTGG - Intronic
1116396485 14:44453041-44453063 AATTCTGGGCACAATAGGGCTGG - Intergenic
1116523742 14:45880111-45880133 AATATTAGGTAGAAAAGGTCCGG + Intergenic
1116716408 14:48431753-48431775 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1117326568 14:54674269-54674291 ATTTTTAGGGAGGGAAGGGCAGG + Intronic
1117450616 14:55846029-55846051 AATACTACGTAGAAAAGGGTGGG - Intergenic
1117733307 14:58745599-58745621 TACTCAAAGGAGAAAAGGGCAGG - Intergenic
1118408570 14:65452005-65452027 AATTCTAGGCAGAAAATGGTGGG - Intronic
1119562619 14:75603147-75603169 AATTCTAGGCAGAAAAGGGTGGG + Intronic
1120422141 14:84302094-84302116 ATTCCTAGGCAGAAAGGGGCGGG + Intergenic
1120493345 14:85204285-85204307 AATTCTAGACAGAAAACAGCAGG + Intergenic
1121448739 14:93994715-93994737 ACTTCTAGGAAGAAAAGTCCTGG + Intergenic
1122007618 14:98718423-98718445 AAGTCTAGTGTGGAAAGGGCAGG + Intergenic
1122643278 14:103175050-103175072 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1123765206 15:23471165-23471187 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1126212049 15:46111145-46111167 AATTCTAGGCAGAAAAGAGTGGG + Intergenic
1126333796 15:47564656-47564678 AATTCTAGGGAGAAAAGGGCGGG + Intronic
1126654174 15:50957565-50957587 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1127152243 15:56087987-56088009 ATTTCTATGGAGAGAAGGGAGGG + Exonic
1127619735 15:60722128-60722150 GAGTTAAGGGAGAAAAGGGCAGG - Intronic
1128056139 15:64701664-64701686 AAATCTGGGGACAAAAGGTCTGG + Intronic
1128229712 15:66025921-66025943 ACTTAAAAGGAGAAAAGGGCAGG + Intronic
1128804282 15:70519077-70519099 CATTCTAAGGGGAAAAAGGCAGG - Intergenic
1128870403 15:71151048-71151070 AATGCTATGGAGAAAAGGGCTGG + Intronic
1129766762 15:78174521-78174543 AATTCTGGGGAGGCAAGGCCAGG + Exonic
1130115142 15:81000313-81000335 ATTTCAAGGGAGGAACGGGCAGG + Intergenic
1131814744 15:96211037-96211059 AACTCTGGGCAGAAGAGGGCAGG + Intergenic
1131881483 15:96867393-96867415 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1131931554 15:97448584-97448606 AATTCTGGGCGGAAGAGGGCAGG + Intergenic
1132660016 16:1057195-1057217 AATTCTAGGTAGAAAAAGATGGG - Intergenic
1132920820 16:2391020-2391042 AATTTTAGAGAAAAAAGGCCAGG - Intergenic
1133662043 16:7927695-7927717 GATTCTAGGGAGGACAGGACCGG - Intergenic
1133850775 16:9501199-9501221 AAGCCTAGGGAGGAAAGAGCAGG - Intergenic
1134353977 16:13463854-13463876 AATTCCAGGGAGCCAACGGCAGG - Intergenic
1135386902 16:22050509-22050531 ACTTCTAGTGAGTAAAGGCCAGG + Intronic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1137815624 16:51395245-51395267 AATTCTGGGCAGACAGGGGCAGG + Intergenic
1137826796 16:51504780-51504802 GATTCTCCGGAGAAAAAGGCTGG - Intergenic
1138035532 16:53602185-53602207 AAAACTAGGGAGAAAAGAGCAGG + Exonic
1138114346 16:54348580-54348602 AAATATAGGGAGAAATGTGCTGG + Intergenic
1138852141 16:60641871-60641893 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1139555157 16:67703571-67703593 AATTCCAGACAGAAAGGGGCAGG - Intronic
1140075976 16:71699183-71699205 AATTCTAGGCAGACAGGGACAGG + Intronic
1140324841 16:73991506-73991528 AATTCTAGGCAGAAAAGTCAGGG - Intergenic
1140564544 16:76026665-76026687 GATACTAGGTAGAAAAGGGCGGG + Intergenic
1140748195 16:77999491-77999513 AATGCTAGGTAGAGAAGGGCTGG - Intergenic
1140805773 16:78530703-78530725 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1142301813 16:89263019-89263041 AATTCTAGGCAGACAGGGGCAGG - Intergenic
1142878422 17:2866340-2866362 AATGCTGGGGAAAGAAGGGCAGG + Intronic
1143064968 17:4240018-4240040 AATTGTAAAGAGAAAAGAGCAGG - Intronic
1143465615 17:7134310-7134332 AGTGCTGGGGAGAGAAGGGCGGG - Intergenic
1143552050 17:7636354-7636376 GATTCCAGGGACAAAAGGTCAGG - Intergenic
1143579660 17:7818129-7818151 GATGCTAGGGAGGGAAGGGCTGG + Intronic
1146178761 17:30684007-30684029 AACTATAGGGAGGAAAGGGATGG + Intergenic
1146549518 17:33768585-33768607 AATCCTAGGCAGACAGGGGCAGG + Intronic
1147032812 17:37654352-37654374 AATTCCAGGGAGGCTAGGGCTGG + Intergenic
1147230122 17:39011651-39011673 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1147513402 17:41093649-41093671 AATTCTAGGCAGAAAAGGATAGG + Intronic
1147515492 17:41113944-41113966 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
1148537716 17:48454840-48454862 AATTCTCGGCAGAAAAGGGCAGG + Intergenic
1149237233 17:54606877-54606899 AATTATAGGCAAAAAAGGGCAGG + Intergenic
1149384086 17:56124818-56124840 AAATATGGGGAGAAAAGGGCTGG - Intronic
1149751747 17:59153406-59153428 AAGTGTAGGGAGAAATGGGAGGG - Intronic
1149911333 17:60569611-60569633 GATGCGAGGGAGAAAAGGGAGGG - Intronic
1149980733 17:61309301-61309323 CATTCTAGGGTAATAAGGGCTGG + Intronic
1150932031 17:69595635-69595657 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1153703163 18:7717112-7717134 AATTCTAGGCAGAAAAGGGATGG + Intronic
1153703892 18:7725405-7725427 AATTCTGGGCAGAAAAGGACGGG + Intronic
1154363790 18:13688150-13688172 AATTCTAGGCAGACAGGGACAGG + Intronic
1154384412 18:13880268-13880290 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1154970277 18:21401334-21401356 ATTTCCAGGAAGAAAAGGGGAGG + Intronic
1155017976 18:21864120-21864142 AATTCTAGGCAGACAAGGGTGGG - Intronic
1155676124 18:28430959-28430981 GTTACTAGGGAGAAAAAGGCAGG - Intergenic
1155799923 18:30089108-30089130 AATTCTAGGCAGACAGGGGAAGG + Intergenic
1155840268 18:30633964-30633986 AATTCTAGGCAGACAGAGGCAGG - Intergenic
1156311482 18:35926568-35926590 AATACTGTGTAGAAAAGGGCAGG + Intergenic
1156400705 18:36736852-36736874 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1156713561 18:39977663-39977685 AATTCAAGGCAGAAAAGAGCAGG - Intergenic
1156782990 18:40874733-40874755 AATTCTGGGGAAAAAAAGGGGGG + Intergenic
1156905547 18:42348309-42348331 AATTCTAGGCAGACAGGGGGAGG + Intergenic
1156946970 18:42844832-42844854 AATTCTAGGCAGATAGGGGCAGG - Intronic
1157792509 18:50545465-50545487 AATTCTAGGCAGAAAAGTGCAGG + Intergenic
1158014432 18:52766855-52766877 AATTCTAGGCAGAAAAGGGTCGG - Intronic
1158159581 18:54465704-54465726 AATTCTGGACAGAAGAGGGCAGG - Intergenic
1158193786 18:54861380-54861402 AACTCTACAGAGAAAAGGGATGG + Intronic
1158290207 18:55932311-55932333 AATTCTAGGTAGACAGGGACGGG + Intergenic
1158803873 18:60946295-60946317 AACTGTAGGGATAAAAGGGAAGG - Intergenic
1158856172 18:61544862-61544884 AATGCTGGGTAGAGAAGGGCAGG - Intronic
1158968479 18:62644340-62644362 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1159030584 18:63226395-63226417 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1159167294 18:64720481-64720503 AATTCTAGTTAGAAAAGGGTGGG + Intergenic
1159226361 18:65542643-65542665 AATTCTAGGGGGAGAGGGCCAGG - Intergenic
1159666066 18:71162035-71162057 AATTCTAGGCAGAAGAGGGCAGG + Intergenic
1159777551 18:72620704-72620726 AATTCTAGGCAGACGAGGGTAGG - Intronic
1159857715 18:73608736-73608758 AATTTGAAGGAGAAAAGAGCTGG - Intergenic
1160127406 18:76189277-76189299 AATACTAGGTAGAAAAGGGTGGG + Intergenic
1162178676 19:8851352-8851374 AGGTCTGGGGAGACAAGGGCTGG + Exonic
1162243630 19:9380010-9380032 AATTATTGGGAGAAAAGGTTGGG - Intronic
1162671461 19:12261050-12261072 GTCTCTAGGGAGAACAGGGCAGG + Intronic
1164441304 19:28282555-28282577 AATTCTGGGGAGAAAATGTTGGG - Intergenic
1165300800 19:34967533-34967555 AATTCTGGGCAGAAGAGGCCAGG + Intergenic
1166388036 19:42392950-42392972 GGTTCTGGGGAGAAAGGGGCTGG - Intergenic
926523158 2:13943052-13943074 AATCTTAGTGAGCAAAGGGCTGG - Intergenic
926542953 2:14204266-14204288 AATTCTAGGCAGAAAAGAGCAGG + Intergenic
927189935 2:20510629-20510651 AATTCCAGGCAGGAAATGGCAGG - Intergenic
927262258 2:21103126-21103148 AATACTAGGTAGAAAAGGGTGGG - Intergenic
927613599 2:24566646-24566668 ACTTCTGGGCAGAAAGGGGCAGG - Intronic
928690029 2:33789687-33789709 GGGTATAGGGAGAAAAGGGCAGG - Intergenic
928813046 2:35253299-35253321 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
928860091 2:35846746-35846768 AATTCTAGGCAGAAAAGTGGCGG - Intergenic
929885966 2:45878978-45879000 AATTCTAGACGGAAAAGGGCTGG + Intronic
929906926 2:46054660-46054682 AATTCGGGGCAGAAGAGGGCAGG + Intronic
930151764 2:48067143-48067165 AATTCAAGGCCGAAAAAGGCAGG + Intergenic
930515384 2:52401463-52401485 AATTCTAGGCAGACAGGGGTGGG + Intergenic
930525472 2:52524475-52524497 AATTCTAGGCAGACAGGGGAGGG + Intergenic
930527221 2:52545328-52545350 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
930533136 2:52615117-52615139 AATACTAGGTAAAAAAGGGCAGG + Intergenic
930818359 2:55621210-55621232 AATCCTAGGCAGACAGGGGCAGG + Intergenic
931462897 2:62463666-62463688 AATTCTAGGCAGAAAAGAGCGGG + Intergenic
931567200 2:63627408-63627430 AATTCTAGGCAGAAAAGGGCGGG + Intronic
931627261 2:64267889-64267911 AATTCTAGGGGGTGGAGGGCTGG - Intergenic
931938893 2:67230560-67230582 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
931995961 2:67839425-67839447 AATTAGGGGGAGAAAAGGGGAGG - Intergenic
933293685 2:80466053-80466075 TATTCTTGGAAGAAAAGGTCAGG - Intronic
933462847 2:82611821-82611843 AATACTAGGAAGAAAAGGGCAGG + Intergenic
933882268 2:86681319-86681341 AATTCTAGGCAGAAAAGAGTGGG - Intronic
934531324 2:95091039-95091061 AATTACAGGCAGAAAAGGGTAGG - Intronic
935042281 2:99444114-99444136 TATTAAAGGAAGAAAAGGGCTGG - Intronic
935277095 2:101484356-101484378 AATTGTGGAGAGGAAAGGGCAGG - Intergenic
935958113 2:108398906-108398928 AATGCTAGGTAGAAAAGTGCAGG + Intergenic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
936858352 2:116987044-116987066 AATTCTGGGCAGACAAGGGCGGG + Intergenic
937319403 2:120951995-120952017 AATTTCAGCCAGAAAAGGGCAGG + Intronic
937840342 2:126518741-126518763 AATTCTAGGCAGAAAAAGGCAGG + Intergenic
937891253 2:126940596-126940618 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
938089610 2:128422670-128422692 AATCCTAGGCAGACAGGGGCAGG - Intergenic
938787830 2:134648506-134648528 AATTCTGGGCAGAAGAGGGTGGG - Intronic
939504349 2:143027104-143027126 AAATCTAGGCAGAAAAGAGTAGG - Intronic
939798629 2:146679205-146679227 TATTCTAGGCAGAAAAGAGTGGG - Intergenic
940418985 2:153456241-153456263 CACTCTAGGCAGAAAAGGGCGGG - Intergenic
940716902 2:157236775-157236797 AATATTAGGCAGAGAAGGGCAGG + Intergenic
940972555 2:159909489-159909511 GATTCAAAGCAGAAAAGGGCAGG - Intergenic
941309550 2:163912233-163912255 AATGCTGGGTAGAGAAGGGCGGG + Intergenic
941427647 2:165368459-165368481 AATTCTGGGCAGAAGAGGACGGG - Intronic
941703051 2:168626293-168626315 TGTTCTAGGGAGACCAGGGCAGG - Intronic
941746791 2:169095467-169095489 AAGTCTAGGGTGCAAAGGGGAGG - Intronic
942183894 2:173406056-173406078 AATTCAAGGCAAAACAGGGCAGG - Intergenic
942669634 2:178360829-178360851 AATTACAGGGGGAAAATGGCAGG - Intronic
943474838 2:188341136-188341158 AATTCTAGGCAGAAAAGGTCAGG - Intronic
943797850 2:192020135-192020157 AATACTAGGGAAAAGAGGGTAGG - Intronic
943969542 2:194386010-194386032 AATTCTAGGCAGAAAAATTCAGG + Intergenic
944001331 2:194842344-194842366 AATTCTAGGCAGTAAAAGGTGGG + Intergenic
944067455 2:195633951-195633973 AATTCTAGGCAGAAAAGGGCAGG - Intronic
944122398 2:196254168-196254190 AATTCTTGGTACAAAATGGCTGG + Intronic
944199443 2:197090585-197090607 AATTCTAGGCAGAAAAGGGCAGG + Intronic
944891135 2:204118154-204118176 AATTCTAGGCAGAAAAGGAAGGG - Intergenic
945330138 2:208529933-208529955 ACTCCTGGGCAGAAAAGGGCAGG - Intronic
945765612 2:213973255-213973277 AAATCTTGGGAGAAAAAGCCAGG - Intronic
946094165 2:217258091-217258113 CTTTATAGGCAGAAAAGGGCTGG - Intergenic
946216009 2:218184092-218184114 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
946284719 2:218694350-218694372 GATGCTAGGGTGAAAAGGGGAGG - Intronic
946563561 2:220939792-220939814 AATTCTAGGCAGGCAGGGGCGGG + Intergenic
946832596 2:223741423-223741445 AGTGCTGGGTAGAAAAGGGCAGG - Intergenic
947227347 2:227853121-227853143 AATTCTAGGTAGACAGGGGCAGG - Intergenic
947563327 2:231177129-231177151 AGATCTAGGCAGAAAATGGCGGG - Intergenic
947581217 2:231319912-231319934 AATTCTGGGGAGAGAAGGAGGGG - Intronic
1169284721 20:4298408-4298430 AGTTCTAAGGACAAAAGGGTGGG - Intergenic
1169394058 20:5214363-5214385 AATAGTAGGGAGAAAGGAGCTGG - Intergenic
1169550288 20:6695354-6695376 AATTCTGGGGAGAACAGTGGGGG + Intergenic
1173473784 20:43344105-43344127 AATTAGTGGTAGAAAAGGGCTGG - Intergenic
1174434992 20:50499930-50499952 AATTCTAGGGAGAAGAAGTTAGG - Intergenic
1175472773 20:59243822-59243844 AATTGTAGAGAGAAAAGTTCAGG - Intronic
1176695551 21:9972797-9972819 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1177124621 21:17181204-17181226 AATTCTGGGTAGAAGAGGGCAGG + Intergenic
1177281373 21:18986998-18987020 AATTCTAGGCAAAAAACGGCAGG + Intergenic
1177555065 21:22678702-22678724 AATTCTAGACAGAAAAGGGCAGG + Intergenic
1177703782 21:24674185-24674207 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1177968408 21:27758724-27758746 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1178002008 21:28172253-28172275 AATTTCATGGAGAAAAGGGAGGG - Intergenic
1178036197 21:28585760-28585782 AATTATAGGGAGAATAGGGAAGG + Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1179594597 21:42433883-42433905 TATTCTGGGGTGCAAAGGGCAGG + Intronic
1180251901 21:46595709-46595731 GCATTTAGGGAGAAAAGGGCTGG - Intergenic
1182264754 22:29105552-29105574 AATTTTAAGAAGAAAGGGGCAGG + Intronic
1182690550 22:32158745-32158767 AATTTTACTGAGAAAAGGGCCGG + Intronic
1183282685 22:36940826-36940848 AATGCTAGGGTGAAAGGGCCAGG - Intergenic
1183343238 22:37293675-37293697 GATCCTGGGGAGAAAGGGGCTGG + Intronic
1183936232 22:41264028-41264050 AACCAAAGGGAGAAAAGGGCTGG - Intronic
1184247896 22:43244923-43244945 GATTCTAGGGACAGAAGGGCAGG - Intronic
1184602159 22:45549958-45549980 ACCTCTTAGGAGAAAAGGGCAGG - Intronic
1184724009 22:46332497-46332519 CATCCTATGGAGAAAGGGGCTGG - Intronic
949227462 3:1711545-1711567 GATTCTAGGCAGACAAGGGCAGG - Intergenic
949258697 3:2081222-2081244 AATTCTAGGCAGACAGGGGTGGG + Intergenic
949631162 3:5928588-5928610 AATTCTAGGCAGAAAAACGTGGG + Intergenic
949727809 3:7070655-7070677 AATTCTTGTGGGAAAAGGGAAGG - Intronic
949949879 3:9220466-9220488 ATTTTTAGGGAGGAAAGAGCAGG - Intronic
949956708 3:9275060-9275082 AACTCTGGGCAGAAGAGGGCAGG - Intronic
950204385 3:11067608-11067630 AATATTAGGTAAAAAAGGGCAGG + Intergenic
950254540 3:11493548-11493570 AACTCTAGGCAGACAGGGGCAGG - Intronic
950978857 3:17280313-17280335 AATTCTGGACAGAAGAGGGCAGG + Intronic
950997410 3:17518156-17518178 AATTCTAAGCAGAAAAGGGTGGG + Intronic
951134083 3:19083447-19083469 AATACTGGGTAGAAAAGGGAAGG + Intergenic
951238607 3:20264561-20264583 AATTCTAGTCAGACAGGGGCAGG + Intergenic
951251096 3:20395215-20395237 AATTCTGGGAAGAAGAGGGCAGG + Intergenic
951319277 3:21225681-21225703 AATTGTAGACAGAAAAGGGTGGG + Intergenic
951931697 3:27974270-27974292 AATTCTAGGCAGAAAAGGGAGGG - Intergenic
952044151 3:29297816-29297838 CACTCTAGGGAGGCAAGGGCTGG - Intronic
952109716 3:30108773-30108795 AATACTGGGTAGAAGAGGGCGGG + Intergenic
952181401 3:30920396-30920418 AATTCTAGGCAGACAGGGGCAGG + Intergenic
952561714 3:34603334-34603356 AATACTAGATAGAAAAGGGTGGG + Intergenic
953338758 3:42116525-42116547 AATTATAAGGATTAAAGGGCAGG - Intronic
954357073 3:50090753-50090775 AATTTTAGGCAAAGAAGGGCAGG + Intronic
954563594 3:51579401-51579423 AATTCTGGGCAGAAGAGGGCAGG - Intronic
954869879 3:53759642-53759664 AACTCCATGAAGAAAAGGGCAGG + Intronic
954960794 3:54563149-54563171 TATTCTATTGAGAACAGGGCAGG - Intronic
955085416 3:55697883-55697905 AATGCCAAGGAGAAAAAGGCAGG + Intronic
955950416 3:64237727-64237749 AATACTAGGCAGAAAAGGGTGGG - Intronic
956139252 3:66128948-66128970 AAATATTGGGAGAAAAGAGCTGG - Intergenic
956557270 3:70537931-70537953 AATCCTAGGCAGACAAGGGAGGG + Intergenic
956591953 3:70924538-70924560 CATACTTGGGAGAAAATGGCAGG - Intergenic
957244652 3:77702065-77702087 AATACTAGGCAGAAAAGGGTGGG + Intergenic
957414184 3:79879017-79879039 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
957991915 3:87636825-87636847 AATTGTGGGGAAAAAAGAGCAGG + Intergenic
958023898 3:88028108-88028130 AACACTAGGCAGAAAGGGGCGGG + Intergenic
958119337 3:89263847-89263869 AATTCTAGGAAGAAAAGGGAGGG - Intronic
958467387 3:94474022-94474044 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
959120676 3:102228564-102228586 AATTTAGAGGAGAAAAGGGCCGG + Intronic
959155647 3:102663715-102663737 AATACTAGGTAGAAAAGGGCAGG + Intergenic
959212735 3:103409746-103409768 CATTCTAGGCAGAAAGAGGCAGG + Intergenic
960420993 3:117444947-117444969 AATACTAGGTAGAAATGGGCGGG - Intergenic
961159857 3:124714717-124714739 GTTTATAGGGGGAAAAGGGCTGG + Intronic
961432716 3:126894429-126894451 AAACATAGGGAGAAAGGGGCAGG + Intronic
961532218 3:127546869-127546891 AGTTCTAGGGGGAAAAAGGAAGG + Intergenic
962042873 3:131725422-131725444 AATTCTAGTCAGCAATGGGCTGG - Intronic
963409669 3:144911514-144911536 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
963410618 3:144922389-144922411 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
963858378 3:150280383-150280405 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
964987880 3:162766665-162766687 AATCCTAGGCAGACAAGGGTGGG - Intergenic
965300885 3:167002887-167002909 AATACTAGTTAGAAAAGGTCAGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965913422 3:173811266-173811288 AAATGTAGGGAGAAATGGCCAGG + Intronic
967627891 3:191707833-191707855 AATTCTAGCCAGCAAAGGGCAGG + Intergenic
968207011 3:196811976-196811998 AAATGTAGGGAAAAAAGAGCAGG - Intronic
968347212 3:198019378-198019400 AATACCAGGTAGAACAGGGCTGG + Exonic
968726581 4:2250698-2250720 ACTTCTAGGGAGAATAGAGTGGG + Exonic
969018761 4:4124363-4124385 GACGCTAGGAAGAAAAGGGCTGG - Intergenic
969786532 4:9462151-9462173 GACGCTAGGAAGAAAAGGGCTGG + Intergenic
969794444 4:9515799-9515821 GATGCTAGGAAGAAAAGGGGTGG + Intergenic
970131599 4:12877152-12877174 AATTCTAGGCAGAAAAAGGCAGG - Intergenic
970530811 4:16981138-16981160 AATGCTCAGGAGAAAATGGCTGG - Intergenic
970885606 4:20984546-20984568 TTTTCCAGGGAGAAAAGTGCAGG + Intronic
971745510 4:30574692-30574714 ACTTCTAGGGAGGAAGGGCCAGG - Intergenic
971873371 4:32273213-32273235 AATTCTAGTCAGAAAAGTGTGGG - Intergenic
971959871 4:33471643-33471665 AATTCTAGGCAGACAGGGGTGGG - Intergenic
971997426 4:33983211-33983233 TATTCTAGGAAGAAAAGGAATGG - Intergenic
972066488 4:34952830-34952852 AATTCTAGGCAGACAAGGGCAGG + Intergenic
972084335 4:35194929-35194951 AATTCTTGGGAGAAAAAAACTGG - Intergenic
972300241 4:37778709-37778731 TATTTTAAGGAGAAAAGGGGAGG - Intergenic
973022504 4:45220792-45220814 AATTCTAGGCAGACAGGGGCAGG - Intergenic
973113767 4:46428905-46428927 AATTATAGGAAGAAAAGAGGGGG - Intronic
973224948 4:47773428-47773450 AATTCTAGGACTAACAGGGCAGG + Intronic
973233362 4:47868017-47868039 AAATCTAAGAAAAAAAGGGCTGG + Intronic
974505850 4:62771606-62771628 AATTCTAGTCAGAAAAGGGTAGG + Intergenic
974772631 4:66435497-66435519 AATTCAAAGCAAAAAAGGGCTGG - Intergenic
975387091 4:73770321-73770343 AATTCTAGGTAAAAAAGGGCAGG + Intergenic
975947430 4:79724320-79724342 AATTCTATGCAGAAAAGGGCGGG - Intergenic
976042092 4:80898601-80898623 AATTCTGGGAAGAAGAGGGTGGG - Intronic
976287960 4:83388269-83388291 AATTCTGAGAAGAAAAGAGCAGG + Intergenic
976883656 4:89960801-89960823 AATTCTAGGCAGAAAGGGCAGGG - Intergenic
977338757 4:95730420-95730442 AATTCTAGGCATAAAAGGGCAGG - Intergenic
977364910 4:96056018-96056040 AATTCTAGGTAGAAAAGTGCAGG + Intergenic
977781396 4:100985703-100985725 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
977827549 4:101551698-101551720 AATTCTGGGCAGAAGAGGGCAGG + Intronic
978593833 4:110355775-110355797 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
978623065 4:110653901-110653923 AATTCCAGGGAGAAATGGTGAGG - Intergenic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979841535 4:125448240-125448262 AATTTTAGTTAGAAAATGGCAGG + Intronic
979946759 4:126842862-126842884 AATTCTAGGCAGATAGGGGCAGG + Intergenic
979982613 4:127275388-127275410 AATTCTAGGGGGAAAAATGTTGG + Intergenic
980070763 4:128241077-128241099 AATCCTGGGGAGGACAGGGCTGG - Intergenic
980368177 4:131833045-131833067 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
980492982 4:133553135-133553157 AATTCTAGGCAGAAAAGGCAGGG - Intergenic
980680701 4:136155791-136155813 AATTCTAGGCAGACAGGGCCTGG - Intergenic
982786678 4:159544392-159544414 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
982798536 4:159673797-159673819 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
983087496 4:163465526-163465548 AATTATAGGAAGAAAAAGGGAGG - Intergenic
983347663 4:166546965-166546987 ATGTCTAGGCAGAAAGGGGCAGG - Intergenic
983351932 4:166601601-166601623 AATCCTAGACAGAAAGGGGCGGG + Intergenic
983462700 4:168047432-168047454 AATTCCAGGCAGAAAAGGGCAGG - Intergenic
983697927 4:170554989-170555011 AATTCTAGGCAGACAGGGGCAGG - Intergenic
983987233 4:174073868-174073890 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
984129602 4:175857009-175857031 AATACTGGGTAGAAGAGGGCAGG - Intronic
984790163 4:183607762-183607784 AGTGCTGGGTAGAAAAGGGCAGG - Intergenic
985048960 4:185970692-185970714 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
986076251 5:4340795-4340817 AATTCTAGGCAGACAGGGACCGG - Intergenic
986164804 5:5264269-5264291 AATCCTAGGCAGACAGGGGCAGG - Intronic
986577996 5:9232264-9232286 AATTTTAGGGAGGAAAGGTAAGG + Intronic
987268222 5:16278357-16278379 AATACTGGGTAGAAGAGGGCCGG + Intergenic
987926762 5:24351431-24351453 AATACTGGGTAGAAAAGGGCGGG - Intergenic
988350861 5:30106028-30106050 AATTCTGGGCTGAAGAGGGCAGG + Intergenic
988603635 5:32662027-32662049 AACTCTAGGCAGACAGGGGCAGG - Intergenic
988635345 5:32977798-32977820 AATACTGGGTAGAAGAGGGCAGG + Intergenic
988671162 5:33383551-33383573 ACTTCAAGGGAGAAGAGGGAGGG - Intergenic
989585395 5:43070664-43070686 AATCCTAGGGAGACAAGGGTGGG + Intronic
990176597 5:53114809-53114831 AATTTTAGGCAGAAAAGGGAGGG - Intergenic
990248203 5:53884440-53884462 AATTCTAGGGTTACAAGGACAGG + Intronic
990293402 5:54378139-54378161 AATTCTAGGCAGACAGGGGCAGG + Intergenic
990463083 5:56047620-56047642 AATACTGGGTAGAAGAGGGCAGG + Intergenic
990463718 5:56053060-56053082 AATACTAGGTAGAAAAGGATGGG + Intergenic
991169749 5:63608291-63608313 AATTCAGGAGAGTAAAGGGCAGG + Intergenic
991219633 5:64198567-64198589 AATTTCAGGGAGAAGAGGGCAGG + Intronic
993404840 5:87499117-87499139 AATTCTAGGCAGACAGGAGCAGG + Intergenic
993483409 5:88452166-88452188 AATTCCTGGGAGAAAAAGTCTGG - Intergenic
994188135 5:96838174-96838196 AATTCTGGGCAGAAGAGGGCAGG - Intronic
994479441 5:100315170-100315192 AAGGTTAGGGAGAAAAGGGAAGG + Intergenic
994775215 5:104031016-104031038 AATTCTAGGCAGAAAAGGAAAGG + Intergenic
994830479 5:104775222-104775244 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
995420580 5:111962534-111962556 AATCCTAGGCAGACAGGGGCAGG + Intronic
995741927 5:115364566-115364588 AATTCTAGGCAGAAAAAGATGGG - Intergenic
996101565 5:119450323-119450345 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
996242010 5:121215596-121215618 AATACTGGGTAGAAGAGGGCAGG + Intergenic
996502207 5:124229958-124229980 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
996576688 5:124983678-124983700 AATACTAGGTAGAAAAGGGTGGG + Intergenic
996814317 5:127558017-127558039 AACTCAAGGGAAAAATGGGCAGG - Intergenic
997167255 5:131674416-131674438 AAAACTATGGAGAATAGGGCTGG + Intronic
997605567 5:135173524-135173546 TATGCTAGGAAGAGAAGGGCAGG - Intronic
997747128 5:136309104-136309126 AATGCCAAGGAGAAAAGGGCAGG - Intronic
998477948 5:142437092-142437114 AATTCTAGGGATAAGAGCGAAGG - Intergenic
998644040 5:144042525-144042547 AATTCTGGGCAGAAGAGGGAGGG - Intergenic
998774692 5:145586181-145586203 AATTCGTGGGAGGAAAGGGGAGG - Intronic
999060390 5:148627829-148627851 AATTCCTGGGAGAAAATAGCAGG + Intronic
999267539 5:150276653-150276675 AACTCCAGGAAGAGAAGGGCAGG + Intronic
999381883 5:151127089-151127111 AATTCTAAGGAAGAAAGGGGAGG - Intronic
999851177 5:155541365-155541387 AATTCTAGGCAGAAGAGGACGGG + Intergenic
999960945 5:156755108-156755130 AATTTTAGGAAGAAAAGAGGAGG + Intronic
1000233401 5:159335966-159335988 AATTCTAGGCAGAAAAGAGTGGG + Intergenic
1000234504 5:159344889-159344911 AATACTGGGTAGAAGAGGGCAGG - Intergenic
1000537291 5:162494229-162494251 AATTCTAGGCAGGAAAATGCGGG - Intergenic
1000845915 5:166280261-166280283 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
1001969633 5:175944112-175944134 AATTCCAGGCAGAAAAGGGCAGG - Intronic
1002247801 5:177899641-177899663 AATTCCAGGCAGAAAAGGGCAGG + Intergenic
1003166123 6:3679994-3680016 AATCTAAGGGAGACAAGGGCTGG + Intergenic
1004495192 6:16156307-16156329 AATTCTGGGCAGAAGAGGTCGGG - Intergenic
1004977564 6:20984935-20984957 AATTCTGGGTAGAAAAGGGCAGG - Intronic
1004986439 6:21088100-21088122 AATTCTAGGCAGAAAAATGTGGG - Intronic
1006028722 6:31163792-31163814 AAATCTAGGTAGGAAAGGGCGGG - Exonic
1006185144 6:32177335-32177357 AATTATAAAGAGGAAAGGGCGGG + Intronic
1007202018 6:40117512-40117534 AGTTCTAGGGAGTCAAAGGCAGG - Intergenic
1007619477 6:43203325-43203347 AGTTCTAGGGAGCTCAGGGCAGG + Intronic
1007755140 6:44094581-44094603 CATTCCAGGTAGAGAAGGGCAGG + Intergenic
1007931985 6:45700019-45700041 AATACTGGGCAGAAGAGGGCAGG + Intergenic
1008215535 6:48783248-48783270 AATTCTAGGCAGAAAAAGGTGGG - Intergenic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1009461447 6:63919108-63919130 AATTTTGGGGAGAAAGGAGCAGG + Intronic
1009524723 6:64729203-64729225 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1009936654 6:70242186-70242208 TATTCTCAGGAGAAGAGGGCGGG + Intronic
1010125104 6:72422189-72422211 AACTCTAGGGAGAATATGGCAGG + Intergenic
1010294664 6:74182373-74182395 AATTCTAGGCAGACAGGGGTAGG + Intergenic
1010584540 6:77642120-77642142 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1010621843 6:78086021-78086043 AAAACTGGGTAGAAAAGGGCGGG - Intergenic
1010643923 6:78364458-78364480 AAATCTAGGCAGACAGGGGCAGG + Intergenic
1010736547 6:79450343-79450365 AATTCTAGGAAGAAAAGGGCAGG + Intergenic
1011061761 6:83277980-83278002 AATTCTAGGGTTCAAATGGCAGG - Intronic
1011233763 6:85192708-85192730 CATTCTAGGCAGAAAAGGTTGGG + Intergenic
1011261764 6:85477020-85477042 AATACTAGGTAGAAAAGGGTGGG - Intronic
1011408740 6:87043875-87043897 AATTTTAGGCAGACAGGGGCGGG + Intergenic
1011493466 6:87916208-87916230 AATTCTGGGCAGGAAAGGGCGGG + Intergenic
1011820411 6:91246608-91246630 AAAGCTAGGGAAAAATGGGCTGG - Intergenic
1011899590 6:92275431-92275453 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1012112900 6:95259698-95259720 AATACCAGGTAGAAAAGGGAGGG - Intergenic
1012794948 6:103748361-103748383 AGTGCTGGGTAGAAAAGGGCAGG + Intergenic
1012843121 6:104355677-104355699 AATTCTAGGCAGAAAAGTGTGGG + Intergenic
1013218966 6:108059425-108059447 AATTCTGAGAAGAAAAGGGATGG + Intronic
1013492396 6:110660931-110660953 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1013752758 6:113426225-113426247 AATTGCAGAGAGAAAATGGCAGG - Intergenic
1013995666 6:116304775-116304797 CATTCTAGGCAGATGAGGGCTGG - Intronic
1014252267 6:119127177-119127199 AATTCTAGGCATAAAAGGGTGGG - Intronic
1014293129 6:119584176-119584198 AATTCTTGAGAGAAAGGGACAGG - Intergenic
1014812471 6:125902187-125902209 AATACTAGGTAAAAAAGGGTGGG - Intronic
1016084447 6:139895212-139895234 AATTCTAGGTAGACAGGGGCTGG - Intergenic
1016538652 6:145138022-145138044 AATACTAGGGAGAGATGGGCTGG - Intergenic
1016549009 6:145255870-145255892 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1017527041 6:155250449-155250471 TAGTTTAGGGAGAAAATGGCAGG + Intronic
1017584804 6:155909063-155909085 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1018719973 6:166565125-166565147 AATTCCTGGGAGAAAAGAGCAGG + Intronic
1018878038 6:167843290-167843312 TATTGTAGGGAGAAGAGGTCAGG - Intronic
1019042263 6:169117148-169117170 AATTCTAGGCAGAAAAGGACAGG + Intergenic
1019043405 6:169124717-169124739 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020129097 7:5549399-5549421 AGCGCTAGGGAGGAAAGGGCTGG + Intronic
1020263633 7:6545913-6545935 AATTCAAAGGAGAACATGGCTGG + Intronic
1020284169 7:6667496-6667518 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
1020310561 7:6864729-6864751 GATGCTAGGAAGAAAAGGGGTGG - Intergenic
1020739133 7:11990702-11990724 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1021167679 7:17360468-17360490 AATACTAAGTAGAAAAGGGTGGG - Intergenic
1021390313 7:20084982-20085004 AATTCTGTGATGAAAAGGGCAGG + Intergenic
1022104503 7:27188514-27188536 AAATCTAGGGGAAAAAGGGGAGG + Intergenic
1022169626 7:27812725-27812747 AATTCTATGGAGGAAAAGGATGG - Intronic
1022263382 7:28729294-28729316 AATTCTAGGTAGAAATGTGAAGG - Intronic
1022563037 7:31369619-31369641 AGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1022591758 7:31670680-31670702 AATTCTGGGCAGAAGAGAGCAGG + Intergenic
1022679678 7:32532430-32532452 TATTCTAGGCAGAAAAGGGTGGG - Intronic
1022758903 7:33326242-33326264 GATTCAAGGGAGAAGAGGGGAGG - Intronic
1023440311 7:40178633-40178655 ATTTCTAGGGAGAAAAAAGCAGG - Intronic
1024024047 7:45396397-45396419 AAATCTAGAGAGAAAAGGGCAGG - Intergenic
1024808914 7:53184281-53184303 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1024812519 7:53229614-53229636 AATTATAGGGAGATCAGGGCAGG - Intergenic
1026180181 7:68032344-68032366 AATTCTATCGACACAAGGGCTGG + Intergenic
1026280963 7:68921498-68921520 AATTCTAGGCAGAAGAGGGTGGG + Intergenic
1026734257 7:72939392-72939414 AGTCCCAGGGAGAAAAGGGTAGG + Exonic
1026784588 7:73294298-73294320 AGTCCCAGGGAGAAAAGGGTAGG + Intergenic
1026919449 7:74144463-74144485 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1027109482 7:75425630-75425652 AGTCCCAGGGAGAAAAGGGTAGG - Exonic
1028046893 7:86131177-86131199 AATTCTAGGCAGAAAAATGTGGG - Intergenic
1028461353 7:91096641-91096663 AAATTTAGGGAAAAAAGAGCTGG - Intronic
1028501192 7:91520648-91520670 AATTCTGGGAAGAAGAGGGTGGG + Intergenic
1028853010 7:95557772-95557794 AATCCTGGGGAGAAAAAGCCAGG - Intergenic
1028998874 7:97131027-97131049 ATTCCTAGGCAGACAAGGGCAGG - Intronic
1029380587 7:100211890-100211912 AGTTCTTGAGAGAGAAGGGCAGG - Intronic
1030546933 7:110907615-110907637 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1030642358 7:112020956-112020978 AACTCTGGGGAGAAATGGGCAGG - Intronic
1031063472 7:117077355-117077377 AATTCTAGACAGAAAAGGGCAGG - Intronic
1031116336 7:117673038-117673060 AATTCTAGGCAGAAAAGGGCGGG + Intronic
1031681190 7:124676470-124676492 AACACTAGGGAGAAAAGGCCTGG - Intergenic
1031696123 7:124857347-124857369 AATTCTACGCAGAAGAGGGCAGG + Intronic
1032248426 7:130232432-130232454 AATTCTGGGCAGAAAAGGGCAGG - Intergenic
1032625799 7:133590390-133590412 AATACTGGGTAGAAAACGGCAGG + Intronic
1032797591 7:135290207-135290229 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1032917639 7:136510170-136510192 AATTCTAGGCAGAAAAGGATGGG - Intergenic
1033633881 7:143189788-143189810 AATATTAGGTAGAAAAGGGCGGG - Intergenic
1033857231 7:145578182-145578204 AATACTGGGTAGAAAAGGGCAGG - Intergenic
1034093036 7:148381742-148381764 AAATCTAGGCAGAAAGGGGCGGG - Intronic
1034703097 7:153113850-153113872 AAATCTGGGGAGCAAAGGGAGGG - Intergenic
1034823006 7:154234478-154234500 AAGTCTACGGAGAAAATGCCTGG - Intronic
1035292172 7:157846183-157846205 TATTCTAGGAAGAAAAGCGGGGG + Intronic
1036032830 8:4992159-4992181 GATTCTGGGGCGAACAGGGCAGG - Intronic
1036819251 8:11926611-11926633 GATGCTAGGAAGAAAAGGGGTGG - Intergenic
1037258489 8:16981609-16981631 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1037533383 8:19801916-19801938 AACTCTAGGAAAACAAGGGCAGG + Intergenic
1037657781 8:20901016-20901038 AATTGTGGGGAAAAAAAGGCAGG - Intergenic
1038102380 8:24392698-24392720 AATTCACTGGAGAAAAGGGGTGG - Intronic
1038778411 8:30550969-30550991 AAGTCCAGGGAGGAATGGGCTGG - Intronic
1039076330 8:33693461-33693483 AATTCTAGGCAGGCAGGGGCAGG + Intergenic
1039513597 8:38111680-38111702 AAATCTAAGAAGAAATGGGCCGG - Intronic
1039645567 8:39278395-39278417 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1039661305 8:39470506-39470528 AATCCTAGGCAGAAGAGGGTGGG + Intergenic
1039661835 8:39476737-39476759 CATTGTAGGGAGAATTGGGCAGG - Intergenic
1039679129 8:39709528-39709550 AATTTTAGGCAGAAAAAGGCAGG - Intronic
1039880798 8:41624408-41624430 AATTCCAGGAAGGAAATGGCAGG - Exonic
1040663626 8:49604517-49604539 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1040683440 8:49841910-49841932 AATTCTAGGTAGACAGTGGCAGG + Intergenic
1040908349 8:52491876-52491898 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1041035775 8:53788526-53788548 GATTTTATGGAGAAAAGGGCAGG + Intronic
1042004359 8:64165247-64165269 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1042077889 8:65016072-65016094 AATTCTAGACAGAGAAAGGCGGG - Intergenic
1042081517 8:65059582-65059604 AATCCTAGGCAGAAAAGGGAGGG + Intergenic
1042338683 8:67656166-67656188 AATTCTGGAGAAGAAAGGGCTGG + Intronic
1042445955 8:68885191-68885213 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
1042702915 8:71636547-71636569 AATTCCAGAGAGAAAAGAGCTGG - Intergenic
1043286392 8:78537129-78537151 AATTTTGGGAAGAAAAGAGCTGG - Intronic
1043701397 8:83292234-83292256 AATTCTAGGCACAAAAGGGCAGG - Intergenic
1044631076 8:94279020-94279042 AATTCTAGGCAGACACGGGTGGG - Intergenic
1045762592 8:105628411-105628433 AATTCTAGGCAGAAAAGGGTGGG + Intronic
1046387855 8:113526634-113526656 GATCCAAGGGAGACAAGGGCAGG - Intergenic
1046769498 8:118104068-118104090 ACATCTAGTGAGAAAATGGCAGG - Intronic
1046884151 8:119344162-119344184 AATGCGAGGGAGCAAAGGGCTGG - Intergenic
1047878770 8:129169948-129169970 AATTCTGGGCAGAAAAGGATAGG + Intergenic
1048277056 8:133074636-133074658 AATTCTGTGGAGAGAAGGGCTGG - Intronic
1048800351 8:138188928-138188950 AATTCTGGGCAGAAGAGGGAAGG + Intronic
1050756348 9:9008573-9008595 AATTCTATGGAAAAAAAGGATGG + Intronic
1050819222 9:9856401-9856423 AATTCTAGGCAGAAAAGGATGGG - Intronic
1050944348 9:11499028-11499050 AATTCTGGGCAGAAGAGGACAGG + Intergenic
1051301850 9:15660470-15660492 ACTACTAGAGGGAAAAGGGCAGG - Intronic
1051796446 9:20876855-20876877 AATTAAAAGGAGAAAGGGGCAGG - Intronic
1051954191 9:22670043-22670065 AATTATATGGAGAAAAGGTAGGG - Intergenic
1052042471 9:23754828-23754850 GCTTTTAGGGAGAAAAGGGGAGG - Intronic
1052216384 9:25971780-25971802 AATTCTAGGCAGACAGGGGTCGG + Intergenic
1052518746 9:29515155-29515177 CGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1052540487 9:29805000-29805022 AATTCAGGGCAGAAAAGGGCAGG - Intergenic
1052593706 9:30531561-30531583 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1052763808 9:32619847-32619869 ATTTCTAGAGAGTAAAGGGTTGG + Intergenic
1052931681 9:34060912-34060934 AATTCTAGGGGGGAAGGGGAAGG - Intergenic
1053545418 9:39018138-39018160 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1053632534 9:39958748-39958770 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1053773226 9:41504783-41504805 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1053809748 9:41839836-41839858 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1054211354 9:62291949-62291971 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1054313629 9:63556903-63556925 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1054620845 9:67347592-67347614 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1055111154 9:72561016-72561038 AATTAAAGAGAGAAAAGGCCGGG + Intronic
1055375519 9:75645490-75645512 ATTTCTAGGCAGAAAAGGGTGGG - Intergenic
1055376171 9:75649750-75649772 TATTCTAGGCAGAAAAGGGTGGG - Intergenic
1055708525 9:79034220-79034242 AATTCTAGGCAGACAGGGACAGG - Intergenic
1055871872 9:80890022-80890044 GAATCTAGGGAGTAAAGGTCAGG + Intergenic
1056059511 9:82869851-82869873 CATTCTAGGCAGACAGGGGCAGG + Intergenic
1056104014 9:83329110-83329132 ATTTCTAGGGAGGGATGGGCTGG - Intronic
1056119372 9:83472111-83472133 AGTTCTGGGGAAAATAGGGCTGG - Intronic
1056567062 9:87782911-87782933 AATGTTGGGGTGAAAAGGGCAGG + Intergenic
1056573323 9:87834931-87834953 AATGCTGGGAGGAAAAGGGCAGG - Intergenic
1056758525 9:89398036-89398058 AAGTCTAGGCAGACAGGGGCAGG + Intronic
1057147549 9:92768398-92768420 AATTCCAGGTAGAAAAGGGCGGG - Intergenic
1057695221 9:97318319-97318341 AAGTCTGGGGAGGAAGGGGCTGG + Intronic
1057944279 9:99311221-99311243 AATTCTAGGGGGAAAAGTATTGG - Intergenic
1058827981 9:108792251-108792273 AATTCTAGGCAGACAGGGTCAGG + Intergenic
1058829210 9:108800282-108800304 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1058981362 9:110173651-110173673 AATCCTGGGGAGAAAAAGGCTGG - Intergenic
1059002725 9:110366983-110367005 AATTATCTGGAGAAAAGGCCAGG + Intronic
1059408005 9:114113822-114113844 AATTCTGGGGAGAAAAGAGAGGG - Intergenic
1059760646 9:117334230-117334252 CTTTCCAGGGATAAAAGGGCTGG + Intronic
1060506302 9:124200765-124200787 AATTTAAGGAAGAGAAGGGCTGG - Intergenic
1061090095 9:128421361-128421383 AAGGCTGGGGTGAAAAGGGCTGG - Intronic
1061182262 9:129031631-129031653 AATACTAGGCAGACAGGGGCGGG + Intergenic
1061915280 9:133748467-133748489 AAAACTAGGGATAGAAGGGCTGG - Intergenic
1185945155 X:4367587-4367609 AATACTAGGTAGAAAAGGGTGGG + Intergenic
1186033268 X:5392613-5392635 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1186087095 X:6002626-6002648 AATTCTGGGCAGAAGAGAGCGGG + Intronic
1186127157 X:6426333-6426355 AATTCTGGGCAGAAAAGGGAGGG - Intergenic
1186128674 X:6443089-6443111 AATTCTGGGCAGAAGAGGGCGGG - Intergenic
1186767662 X:12788211-12788233 CATTCTAGAGAGAAAAGGACTGG + Intergenic
1186870427 X:13766122-13766144 CAATCTGGGAAGAAAAGGGCAGG + Intronic
1187522953 X:20029426-20029448 AATCCTAGGGAGAAAAGGCCAGG + Intronic
1188182350 X:27072261-27072283 AATTCTGGGCACAAGAGGGCAGG + Intergenic
1188188311 X:27144245-27144267 AATTCCAGGCAGATAAGCGCGGG + Intergenic
1188438052 X:30185379-30185401 AATACTGGGTAGAAAAGGGCAGG + Intergenic
1188527060 X:31098085-31098107 AATTCTAGGCAGACAAGGGTGGG - Intronic
1188553206 X:31383503-31383525 AATTCTGGACAGAAGAGGGCGGG + Intronic
1188554841 X:31399566-31399588 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1188587328 X:31793327-31793349 AGCTCTAGGCAGAAAAGGGATGG - Intronic
1189268761 X:39735912-39735934 AATTCATGCCAGAAAAGGGCGGG - Intergenic
1191053021 X:56214295-56214317 AATTCTAGGCAGAAAAAGCTGGG - Intergenic
1191057306 X:56254966-56254988 AATTCTAGGCAGAAGTGGGCAGG - Intronic
1191767166 X:64710347-64710369 AATACTAGGTAGAAAAGGGCAGG - Intergenic
1193531805 X:82663601-82663623 AGTTCTAAAGAGAAAAGGGGGGG - Intergenic
1193809926 X:86039595-86039617 AATTCTAGGCAGAAAAGGGCAGG + Intronic
1194176257 X:90651714-90651736 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1194615971 X:96103735-96103757 AAGTTTAGGCAGAAAAGGGTGGG - Intergenic
1194690706 X:96980601-96980623 AGCTCTAGGCAGAAAAGGGCAGG - Intronic
1194878902 X:99225636-99225658 AATTCCTGGCAGAAGAGGGCAGG + Intergenic
1194979225 X:100423291-100423313 AATACCAGGTAGAAAAGGGCAGG - Intergenic
1195650532 X:107278677-107278699 AATTCTAGGAAGACAGGGACAGG - Intergenic
1195853274 X:109305862-109305884 AATTCTAGGCAGATAGCGGCAGG - Intergenic
1195854136 X:109311801-109311823 AATTCTAGGCAGACAGGGGTGGG - Intergenic
1195858711 X:109358195-109358217 AATTCTAGACAGAAAAGGGAGGG + Intergenic
1196300713 X:114047411-114047433 AATTTTGGGCAGAAGAGGGCAGG + Intergenic
1196395962 X:115261814-115261836 AATTCTGGGCAGAAGAGAGCAGG - Intergenic
1197340751 X:125263641-125263663 AATTCTAGGCAGAAAAGGATGGG - Intergenic
1197462157 X:126755640-126755662 AATTCTAGGCGGAAAAAGGTGGG - Intergenic
1199219947 X:145306252-145306274 AATTCTAGGCAGAAAATGGTGGG - Intergenic
1199336996 X:146630165-146630187 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1200239306 X:154485646-154485668 AATCCTGGGGAGAGAAGGGCAGG + Exonic
1200522882 Y:4232659-4232681 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1201225502 Y:11814808-11814830 AGTTCTATGGAAAAATGGGCTGG - Intergenic
1201547674 Y:15183933-15183955 AATACTGGGTAGAAAAGGGTGGG + Intergenic
1201609396 Y:15823816-15823838 AATTCTGGGCAGAAAAGGAAAGG - Intergenic
1201639109 Y:16159966-16159988 AATTCTGGGTAGAAGAGGGTGGG + Intergenic
1201663704 Y:16425361-16425383 AATTCTGGGTAGAAGAGGGTGGG - Intergenic