ID: 1126334446

View in Genome Browser
Species Human (GRCh38)
Location 15:47570854-47570876
Sequence GGCCAGGGGTGTCTCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126334439_1126334446 6 Left 1126334439 15:47570825-47570847 CCAACCTAATGCATTAGTGGGTT 0: 1
1: 0
2: 1
3: 1
4: 75
Right 1126334446 15:47570854-47570876 GGCCAGGGGTGTCTCAGTGATGG 0: 1
1: 0
2: 3
3: 18
4: 242
1126334436_1126334446 24 Left 1126334436 15:47570807-47570829 CCAAAGACACAGCAAGGTCCAAC 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1126334446 15:47570854-47570876 GGCCAGGGGTGTCTCAGTGATGG 0: 1
1: 0
2: 3
3: 18
4: 242
1126334441_1126334446 2 Left 1126334441 15:47570829-47570851 CCTAATGCATTAGTGGGTTGGAA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1126334446 15:47570854-47570876 GGCCAGGGGTGTCTCAGTGATGG 0: 1
1: 0
2: 3
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126334446 Original CRISPR GGCCAGGGGTGTCTCAGTGA TGG Intronic
900608646 1:3535167-3535189 GGCCAGGTGTGTCACCGCGACGG + Intronic
900919483 1:5661587-5661609 GGCCAGGGAGGACTCCGTGAAGG - Intergenic
901163525 1:7198589-7198611 GGCCAAGGGGGTATGAGTGATGG - Intronic
902615763 1:17622818-17622840 GGCCAGGGGTGTTATGGTGATGG + Intronic
904349180 1:29893864-29893886 GGCCATGGGTGACTCAGATATGG - Intergenic
905892818 1:41527907-41527929 GGGCAGGGGTGTGTGTGTGAGGG - Intronic
906097528 1:43234464-43234486 GCCCAGGAGATTCTCAGTGAGGG - Intronic
906681725 1:47731154-47731176 TGCCAGGTGTTTCACAGTGATGG - Intergenic
907405099 1:54249025-54249047 GGCCAGGAGAGTCTCACTGCAGG + Intronic
909047635 1:70729175-70729197 GGCCTGGGGTATTACAGTGAGGG - Intergenic
909926090 1:81439615-81439637 GGCCAGGTGTGTCGCCTTGAGGG + Intronic
909936365 1:81555721-81555743 AGACTGGGGTGTCGCAGTGAGGG - Intronic
911390309 1:97233195-97233217 AGCCAGGGATGTGTCAGTGCAGG - Intronic
913213651 1:116602147-116602169 AGCCAGAGGTATCTCAGTGGTGG + Intronic
915139805 1:153760356-153760378 GTCCAGGAGTGTGGCAGTGATGG - Exonic
917795535 1:178530241-178530263 GGCCAGTGCTGTGGCAGTGATGG - Intronic
918133065 1:181645972-181645994 GGCCAGGTATGTGTCTGTGAGGG + Intronic
919053438 1:192539616-192539638 GGCCAGGGGAGGCCTAGTGAGGG - Intergenic
919932664 1:202231398-202231420 GTACAGGGGTGACTCAGAGAGGG - Intronic
921047836 1:211490166-211490188 GACCAGGGATGTCTCAATGGTGG + Intronic
921808828 1:219488381-219488403 GGCCAGGGGTTCCAAAGTGAAGG + Intergenic
922683031 1:227616700-227616722 GTCCGGGGGTGTCTCAGAAAGGG + Intronic
923982312 1:239338865-239338887 GGCCAGGGCGGTCTCAGTGAAGG - Intergenic
1062785708 10:263065-263087 GGCCATACTTGTCTCAGTGATGG - Intergenic
1063519801 10:6730903-6730925 GGCCAGGGGTGATTCTGTGAGGG + Intergenic
1064362629 10:14679706-14679728 GTCCCGGGGTGTGTCTGTGAGGG + Intronic
1065382372 10:25103054-25103076 CTCCAGGACTGTCTCAGTGAAGG + Intergenic
1065834700 10:29646200-29646222 GGGCAGGGGGGTGTCTGTGAGGG - Intronic
1066723537 10:38365629-38365651 GGTAAGGCCTGTCTCAGTGACGG + Intergenic
1067938361 10:50630997-50631019 GGCCAGGGGTTTCTCTGGGCAGG + Intergenic
1071166670 10:82815818-82815840 AGCCAGGGGTGCAGCAGTGAGGG + Intronic
1071278975 10:84082261-84082283 GGCCATGGGTGTCAAAGTCAGGG - Intergenic
1076082974 10:127600167-127600189 GTCTAGGGCTGTCTCAGTGTGGG + Intergenic
1076132327 10:128021998-128022020 GTCCAGGGGAGACGCAGTGATGG - Intronic
1077110371 11:859562-859584 GGCCCGGGGTGCATGAGTGAGGG - Intronic
1077533486 11:3108059-3108081 GGCCAGGGGTGGGTCTGGGATGG - Intronic
1078544558 11:12237634-12237656 GTCCAGGGCTGTCTCAGAAAGGG - Intronic
1081283886 11:41245359-41245381 AGCGAGGGGTGTGTAAGTGAGGG + Intronic
1081308098 11:41537880-41537902 GACCAGGGTTGTTGCAGTGAAGG + Intergenic
1081787448 11:45757386-45757408 GGCCAGCTCTGTCTCTGTGAGGG - Intergenic
1082792794 11:57358984-57359006 AGCTAGGGGTGTCTCAGTGAAGG + Intronic
1083679513 11:64344701-64344723 GGCCAGTGGTGTCGCAGAGCAGG + Exonic
1084020590 11:66415076-66415098 GGGCAGGGGGGTCTCAGGGCTGG - Intergenic
1084668689 11:70592512-70592534 GGCCAGGGGAGTCTTTCTGAAGG + Intronic
1085036319 11:73302378-73302400 GCCCAGGGGTCTCTGAATGATGG + Intergenic
1086215099 11:84369744-84369766 ACCCTGGGGTTTCTCAGTGAAGG - Intronic
1087555881 11:99720517-99720539 GGCCAGGGGTTTGTCATAGAAGG - Intronic
1088499371 11:110467802-110467824 GGCCAGGTGCTTCCCAGTGATGG - Intergenic
1093881836 12:24413449-24413471 GGCCACAGGTGAATCAGTGACGG + Intergenic
1096575894 12:52552739-52552761 GGCCAGGAGGCTCTCATTGACGG + Exonic
1097271823 12:57780267-57780289 GGCCAGGGGCAGGTCAGTGATGG - Exonic
1100689953 12:97029055-97029077 GGCCTGGGGGGTAGCAGTGAAGG + Intergenic
1102040959 12:109800508-109800530 GGCCCTGGGTGTCTGGGTGATGG + Intronic
1103436051 12:120926133-120926155 CGCCAGGGGTTTCTCAGTTGGGG - Intergenic
1103995668 12:124828473-124828495 GGGCAGGGGCGTCTCAGGGCAGG - Intronic
1105295423 13:19085143-19085165 GGGCAGGGGTGGCACAGTGCAGG - Intergenic
1105474457 13:20718598-20718620 GGGCAGGTGTGTCTGAGTGTGGG - Intronic
1105474499 13:20718827-20718849 GGGCAGGTGTGTCTGAGTGTGGG - Intronic
1105603438 13:21907878-21907900 GGCCTGGGGTCTCACAGTGGTGG - Intergenic
1107733056 13:43367755-43367777 TGCCAGGGGAGTGTCAGGGAAGG + Intronic
1110614307 13:77523981-77524003 GGCCATGGGTGTGTAAGTTAAGG + Intergenic
1110827705 13:79991815-79991837 GTCCAGGTGAGTGTCAGTGAGGG - Intergenic
1112333422 13:98494832-98494854 GCCCCGGGGTGCCTCAGTGCGGG - Intronic
1112397117 13:99043392-99043414 GGGCAGGGGTGCCTCCGGGATGG - Intronic
1112819781 13:103318885-103318907 GGTTATGGGTGTGTCAGTGAGGG + Intergenic
1113378540 13:109784464-109784486 GGCCGGGGGCGTCTCCGCGATGG + Exonic
1113420723 13:110169852-110169874 GTCCAGTGTTGTATCAGTGAGGG - Intronic
1114481062 14:23034769-23034791 GGTCCAGGGAGTCTCAGTGATGG - Exonic
1119008563 14:70958691-70958713 GGCCAGGAGTGTCTTATTGGTGG - Intronic
1119190908 14:72681072-72681094 GGCCAGGGATACCGCAGTGAAGG - Intronic
1119419480 14:74499872-74499894 GGGCAGGGGTTTCTGAGTGGAGG + Exonic
1119485523 14:74984464-74984486 GGGGAGGGGTGGCTCAGAGAGGG + Intergenic
1122058258 14:99119644-99119666 GGCCAGGGCTCTCTCAGGGTTGG - Intergenic
1122071009 14:99205319-99205341 GGCCTGGGCCGTCTCAGTTAGGG - Intronic
1122974969 14:105167351-105167373 GGCCCGGGGCGGCTCAGTCAGGG + Intronic
1123065696 14:105618177-105618199 GGCCCCGGGTGGCTCAGGGAGGG + Intergenic
1123069859 14:105637422-105637444 GGCCCCGGGTGGCTCAGGGAGGG + Intergenic
1123089093 14:105734210-105734232 GGCCCCGGGTGGCTCAGGGAGGG + Intergenic
1123094880 14:105762367-105762389 GGCCCCGGGTGGCTCAGGGAGGG + Intergenic
1124982127 15:34576161-34576183 GGCCAGGGTTGCCAAAGTGAGGG + Intronic
1126334446 15:47570854-47570876 GGCCAGGGGTGTCTCAGTGATGG + Intronic
1126363637 15:47871512-47871534 GGCCAGGGTTCTCTGGGTGAGGG - Intergenic
1128785048 15:70389066-70389088 GGCCAGGGGTACCCCAGTGAGGG + Intergenic
1132386003 15:101400331-101400353 GGCCAGGGGTGTGTGCATGATGG - Intronic
1132478544 16:154245-154267 GGGCGGGGGCGGCTCAGTGAGGG - Intronic
1132499617 16:279711-279733 GGCCAGGGGTGTCTAAGAAAGGG + Intronic
1132895913 16:2229327-2229349 GGCCAGAGGTGTGAGAGTGACGG + Intronic
1133171665 16:3985832-3985854 GGCCAGGGGTGGCCCAGAGGGGG - Intronic
1134018579 16:10906469-10906491 GGCCAGGGGCGTGTCAGGGTGGG - Intronic
1134078294 16:11307817-11307839 AGCCAGGTGTGGCACAGTGAGGG + Intronic
1135842731 16:25891411-25891433 GGCTAGGGGTAACTCAATGATGG + Intronic
1138658651 16:58504691-58504713 AGCCAGGGATGTCCCAGTGGTGG + Intronic
1138689456 16:58753893-58753915 GACCAGGTGTGTCACACTGAGGG + Intergenic
1139491700 16:67289392-67289414 GGCCTTTGGTGTCTCAGAGAAGG + Exonic
1139527896 16:67528061-67528083 GGCCAGGGGTGTCTGATTGATGG + Intronic
1140130035 16:72152430-72152452 GGCCAGGGATATTTAAGTGAAGG + Intronic
1141946072 16:87310952-87310974 GGGCAGGTGTGGCTCAGGGAGGG - Intronic
1142071155 16:88091813-88091835 CGCCAGGCGTGCCTGAGTGAGGG + Intronic
1142135198 16:88448739-88448761 GCACAGGGGTGGCTGAGTGAGGG - Intergenic
1142492738 17:289274-289296 AGCCATGCCTGTCTCAGTGAAGG + Intronic
1142976180 17:3645971-3645993 GGCCTGGGGGGTCTGAGTGACGG + Intronic
1143579665 17:7818182-7818204 GGCCAGGGCTGTCTGAATGGAGG - Intronic
1144639583 17:16930242-16930264 GGCCAGGGCTGTCCCTGGGAGGG - Intronic
1144646038 17:16974285-16974307 GGTGAGGGGGGACTCAGTGAGGG - Intergenic
1145119678 17:20246469-20246491 GGCCAGGGGTGCCTCCAAGAGGG - Intronic
1146463635 17:33067629-33067651 CACCAAGGGTGTCTAAGTGAGGG + Intronic
1146787937 17:35734652-35734674 GGGCAGGTGTGTCTCAGTGCTGG - Intronic
1149657874 17:58319737-58319759 AGCCAGGGATGTCTTCGTGATGG + Intronic
1151767371 17:76139353-76139375 GGCCAGGTGTGTCCCAATGGAGG - Intronic
1152721088 17:81924124-81924146 GGCCCGGGGTGGCTCACTGTGGG - Intronic
1154112216 18:11579854-11579876 GGCCACGTTTGTCTCAGGGAGGG - Intergenic
1155269719 18:24128036-24128058 GGCCAGGTGTGTCTGAGAGCAGG - Intronic
1159226990 18:65552214-65552236 TGCCAGGAATGTATCAGTGAAGG + Intergenic
1160190673 18:76711921-76711943 GGGCAGGGGTCACTCACTGAAGG - Intergenic
1160258048 18:77264305-77264327 GGACAGTGCTGTCTCAGTCATGG + Intronic
1160538948 18:79610212-79610234 TGCCTGGGGTGGCTCAGTGGCGG - Intergenic
1160538960 18:79610245-79610267 GCCCTGGGGTGGCTCAGTGGCGG - Intergenic
1160927063 19:1551760-1551782 GGCCAGGGGTGTCACCATGCTGG - Intergenic
1161054009 19:2180884-2180906 GATCAGGGGTGACTCAGGGACGG + Intronic
1161852346 19:6744354-6744376 GGCCAGGGGGATCTCAGAGGGGG - Intronic
1162460110 19:10809863-10809885 GGCCATGGGTGGGGCAGTGACGG + Intronic
1163375448 19:16927582-16927604 GGCCTGGGGGGTCTTGGTGATGG - Intronic
1163398387 19:17076970-17076992 GGCCAGGGGTCTTTAAGGGATGG + Intronic
1166686543 19:44800087-44800109 GGACAGGGGTGACACAGTGGTGG - Intronic
1167490987 19:49792536-49792558 AGCCAGGGGAGTGTCAGAGATGG - Intronic
1167592026 19:50409298-50409320 GCCCTGGGGTGTCCCAGTGAGGG - Intronic
925347066 2:3178879-3178901 GGGCACGGGTGTCTGAGTGGTGG - Intergenic
925770178 2:7274549-7274571 GTCCTGGGGAATCTCAGTGAAGG + Intergenic
926554893 2:14345711-14345733 GGTCCGGGGTGTGTCTGTGAGGG + Intergenic
927645433 2:24874215-24874237 GGTCAGGCGAGTCTCAGTGCTGG + Intronic
927999992 2:27515460-27515482 GGCCAGGGGTGTCACCATGTTGG + Intronic
928175804 2:29033632-29033654 GGCCAGGGGTGGCTCTGGGGTGG + Intronic
929589760 2:43137345-43137367 GGCCAGGGGCGTCCCACTGGAGG - Intergenic
929890290 2:45912989-45913011 GGTCAGGAGTCACTCAGTGAGGG + Intronic
930818465 2:55621950-55621972 GACCAGGTGTGTCACATTGAGGG - Intergenic
931238570 2:60432735-60432757 TGACAGGAGTGTCTCAGGGAGGG - Intergenic
932741487 2:74294146-74294168 GGTCAGGGGAGACTCAGTCAAGG + Intronic
932929515 2:76017217-76017239 GGCCATGGGTGTCTGAGAAATGG + Intergenic
934168877 2:89322320-89322342 GGACAGGGATGCTTCAGTGATGG + Intergenic
934198414 2:89860264-89860286 GGACAGGGATGCTTCAGTGATGG - Intergenic
935356008 2:102200556-102200578 GGCCAGGCCTGTCACAGTGCAGG + Intronic
937308001 2:120884073-120884095 GGCCAGGGGCAGCTCAGTGCTGG + Intronic
941284644 2:163594289-163594311 GGCCAGGGGTTTGTCATTGATGG + Intronic
944408754 2:199415784-199415806 GGCCAGGAGGGTCACAGTGCAGG - Intronic
947750796 2:232530890-232530912 GGGCTGGGGTCTCTGAGTGAGGG + Intronic
1168924124 20:1565850-1565872 GGACAGAGGGGTCTAAGTGAGGG - Intronic
1169391828 20:5196976-5196998 GGCCAGGAGTCTCACAGTGGAGG + Exonic
1171359069 20:24573906-24573928 GCCCAGGGGTGTCTCAGGCAAGG - Intronic
1172182425 20:33011545-33011567 GCCCAGGGGTGTCTAAGTTTGGG - Intronic
1172483447 20:35285030-35285052 GGCCAGGAGTGTCTCGCGGAAGG + Intergenic
1173833382 20:46108158-46108180 GGCCAGGGATGTTACAGTCATGG - Intergenic
1174340296 20:49891108-49891130 GGCCTGGGGTGGCTCAGGGCTGG + Exonic
1175124908 20:56744098-56744120 GGCCACAGGTGTCTCATTCAGGG + Intergenic
1175465110 20:59185529-59185551 CCCGAGGGGTGTCTCAGTGGGGG - Intergenic
1175561820 20:59937243-59937265 GGCCAGGGGCGTAGCAGTGAAGG + Exonic
1175904679 20:62373881-62373903 GGCCCGTTGTGTCCCAGTGATGG - Intergenic
1175934123 20:62507350-62507372 GGCCAGGGAGGTCCCAGTGATGG + Intergenic
1176256894 20:64157690-64157712 TGCGAGGGGTGTCTCCGTGATGG + Intronic
1179047143 21:37856087-37856109 GGCCATGGCTTTCTGAGTGATGG - Intronic
1179077859 21:38140889-38140911 GACCCTGGGGGTCTCAGTGATGG + Intronic
1179473860 21:41631060-41631082 GGCCTGGGCTGTCCCAGGGAAGG + Intergenic
1179554250 21:42162514-42162536 GGGCAGGGGTGTGTGAGAGAGGG + Intergenic
1179554371 21:42163028-42163050 GGGCAGGGGTGTGTGAGAGAGGG + Intergenic
1180000112 21:44991709-44991731 GGCCAGGGGACCCTCAGCGACGG - Intergenic
1180182027 21:46122301-46122323 GGCTTCGGGTGACTCAGTGAAGG + Intronic
1181290829 22:21791757-21791779 TGGCAGGGTTGTCACAGTGAGGG - Intronic
1183314366 22:37128862-37128884 GGCCAGGGGTGGGTGAGTGGGGG + Intronic
1184298207 22:43539611-43539633 GGCCTGGGGTGGCTCAGCCAGGG + Intronic
1184369574 22:44074112-44074134 AGCCAGGGGTGTGTGAGTGGGGG + Intronic
1184812926 22:46849285-46849307 GGCTAGGGCTGCCTGAGTGATGG - Intronic
949441475 3:4085654-4085676 GGCCAGGGTGGTCTAGGTGAAGG - Intronic
950496654 3:13337960-13337982 GGCCAGGGATGTTTCAGGAAGGG + Intronic
950627725 3:14260435-14260457 GGCCAGGATTGTCTCAGGGCCGG + Intergenic
950766730 3:15278308-15278330 CCCCTGGGGGGTCTCAGTGAGGG + Intronic
952272617 3:31847697-31847719 AGTCAGAAGTGTCTCAGTGAGGG + Intronic
954130663 3:48559103-48559125 GGCCAGGGCTATCTCTGGGAAGG + Intronic
956027655 3:65000856-65000878 CCTCAGGGGTGTCTCAGTGAGGG - Intergenic
958562069 3:95759753-95759775 GGCTAAGGGTGGCTCAGTGCAGG - Intergenic
961450340 3:126999673-126999695 GGCCAGGGCTGTGGCGGTGATGG + Intronic
961564099 3:127751083-127751105 TCCCAGGGATGTCTCAGTGGTGG - Intronic
966388618 3:179428482-179428504 GGCCAGGGATATCTCAGGAATGG - Intronic
968830944 4:2932801-2932823 GGCCAGGAGTGGCTCAGAGTAGG + Intronic
969337051 4:6517172-6517194 AGACAGGGGTCTCTGAGTGAGGG + Intronic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
970415558 4:15853390-15853412 GTCCTGGTGTGTCTCAGTGGTGG + Intergenic
977460431 4:97318923-97318945 GCACAGGGGTGTCAAAGTGATGG - Intronic
978409572 4:108412148-108412170 GGGCTGGGGTGGTTCAGTGATGG - Intergenic
979301846 4:119095436-119095458 TGCCAAGAGTGTCTTAGTGAAGG - Intergenic
982131614 4:152233835-152233857 TGCCAGGGGTGCCTCAGTGGGGG + Intergenic
982657841 4:158171115-158171137 ATCCAGGGGTATCTCAGGGAAGG + Exonic
983699917 4:170579327-170579349 AGCCAGGGAGGTCTCAGTGGAGG + Intergenic
985196560 4:187436413-187436435 GGCCAAGCGTCTCTCAGGGAAGG + Intergenic
985510212 5:309240-309262 GGCAAGGGGTGTGTCAGGGGTGG + Intronic
985746910 5:1652966-1652988 GGCCGGGTGTCTCTCTGTGAGGG + Intergenic
987374061 5:17217954-17217976 GGCCTGGGGTCCCTCTGTGAGGG + Intronic
989471301 5:41822199-41822221 GGCCAGGGGTTTCTCAGAGCTGG + Intronic
991028077 5:62052275-62052297 GGGCCGGTGTGTGTCAGTGAGGG + Intergenic
992552289 5:77870233-77870255 GGTCAGGGGCTTCTCAGTGGAGG + Intergenic
992818679 5:80471511-80471533 GGGCAGGGGTAGCTTAGTGAGGG - Intronic
997129774 5:131264559-131264581 GGCCCGGGGTCTCTAGGTGAGGG + Intronic
997404447 5:133633919-133633941 TGCCAGGGAGGTTTCAGTGAAGG - Intergenic
999065756 5:148683896-148683918 GTCCAGTGGGGCCTCAGTGAGGG - Intergenic
1003029794 6:2592280-2592302 AGGCAGGGATGTCACAGTGATGG + Intergenic
1003274435 6:4637155-4637177 GTTCAGGGGTGTCTCAGCTAAGG + Intergenic
1004015622 6:11729372-11729394 GGAAGGGGGTGTCTCAGGGAGGG - Intronic
1005026490 6:21467265-21467287 GGCCAGGTGTGTCACCTTGAGGG - Intergenic
1007290039 6:40778602-40778624 CGCCAGTGGTGTCTCACTGGTGG - Intergenic
1008150784 6:47949119-47949141 GGCTAGGGATGTCAAAGTGACGG + Intronic
1008368932 6:50712120-50712142 GGGCAGGGGTGCCTGAGTTAAGG + Intergenic
1008382301 6:50849301-50849323 GCCCAGGGCTGTCTTAGTCAAGG - Intergenic
1009582160 6:65549953-65549975 GGCCAGAAATGTCTCAGGGAGGG + Intronic
1013467217 6:110428344-110428366 GGCCAGAGCTGTCTTAGAGAAGG + Intronic
1013596607 6:111666302-111666324 GGCCAGTGGTGTCTGACTGTGGG + Intronic
1013968044 6:115979623-115979645 GACCCTGGGTGTGTCAGTGAAGG - Intronic
1018593268 6:165451567-165451589 GGCCAGGGTTGTGACAGTGAGGG - Intronic
1021888423 7:25163621-25163643 AGCCAGGTGAGTCTTAGTGAGGG - Intronic
1024006736 7:45229796-45229818 GTGGAGGGGTGTCTCAGTGAGGG + Intergenic
1026058174 7:67003384-67003406 GACCAGGGGAGTAGCAGTGAAGG - Intronic
1026719915 7:72821628-72821650 GACCAGGGGAGTAGCAGTGAAGG + Intronic
1027167568 7:75846446-75846468 GGGCAGGAATGTCTCAGTGCAGG + Intronic
1028850055 7:95527942-95527964 GGCCAGGGGGGTCTCCATGTGGG - Exonic
1028979598 7:96953211-96953233 GGCCAGGAGTGCCTGGGTGAAGG + Intergenic
1028979603 7:96953266-96953288 GGCCAGGAGTGCCTGGGTGAGGG - Intergenic
1030196541 7:106858811-106858833 TGCAGGGTGTGTCTCAGTGAGGG - Intergenic
1030265206 7:107614088-107614110 GGCCAGGGCTGTCTCTGGAATGG - Intronic
1033968415 7:147007230-147007252 GGCCAGGTAAGTCTCAGTGAGGG + Intronic
1037035592 8:14162795-14162817 GGCCAGGGGATACCCAGTGAGGG + Intronic
1037289378 8:17335230-17335252 GGCCCTGAGTGTCTCATTGATGG + Intronic
1037596409 8:20358000-20358022 GGCCAGAGGTTTCTAAATGATGG - Intergenic
1038269370 8:26062743-26062765 GGCCAGGTGTGGCTCACAGATGG - Intergenic
1038696657 8:29812450-29812472 GTTCAGGGGTGTCTCAGGGCAGG + Intergenic
1042559322 8:70061157-70061179 GTCCAGGGGTGTCTATGTGTTGG + Intronic
1045917274 8:107487093-107487115 GGGGAGGGGTGACACAGTGAGGG - Intronic
1049050939 8:140194744-140194766 GGTCAGGGGTGTGTAAGTGTAGG - Intronic
1049576582 8:143392559-143392581 GCCCAGGAGTGTCTCAGTCCTGG + Intergenic
1049790029 8:144468291-144468313 GGCCAGGAGGGACTCAGAGAGGG - Intronic
1053471194 9:38347054-38347076 GCCCAGGGGTGTGTGTGTGAGGG + Intergenic
1053610871 9:39711847-39711869 GTCCAGGGATGTCCCAGAGAGGG - Intergenic
1053868908 9:42469869-42469891 GTCCAGGGATGTCCCAGAGAGGG - Intergenic
1054087383 9:60759311-60759333 GTCCAGGGATGTCCCAGAGAGGG + Intergenic
1054242651 9:62630548-62630570 GTCCAGGGATGTCCCAGAGAGGG + Intergenic
1054556775 9:66665066-66665088 GTCCAGGGATGTCCCAGAGAGGG + Intergenic
1056968026 9:91180393-91180415 GGCGAGGGCTGACTGAGTGATGG - Intergenic
1057452199 9:95174792-95174814 GGCTAAGGGTGCCTCAGTGATGG + Intronic
1058270525 9:102967166-102967188 AGCAAGGGGTGTGTGAGTGAGGG + Intergenic
1059401358 9:114072400-114072422 GGCAAGGGATGTGTGAGTGAGGG - Intronic
1060221467 9:121766242-121766264 GGGCAGTGGGTTCTCAGTGAAGG - Intronic
1060892643 9:127198511-127198533 GGCCAGTGGGGTCACAGAGAGGG - Intronic
1061574811 9:131499556-131499578 GGACAGGAGTGGCTCAGTGTTGG + Exonic
1062583350 9:137237818-137237840 AGCCAGGGGTGCCTCAGGGGTGG + Intergenic
1062703713 9:137922526-137922548 GGCAAGGGCGGTCTCAGTGGTGG + Intronic
1185466890 X:360613-360635 GGGCAGGGGTCTCACCGTGAGGG + Intronic
1187098005 X:16167265-16167287 GGCCTGGAGGGTCTCAGGGAAGG + Intergenic
1187814675 X:23218110-23218132 GGCCACGGGTGTCTATGAGAAGG - Intergenic
1189247225 X:39572517-39572539 GGCCCTGGGAGCCTCAGTGAAGG + Intergenic
1190275093 X:48894080-48894102 GGCCAGGGGTCACTCACTGCGGG + Exonic
1190724718 X:53181389-53181411 TGCCAGGGGAAACTCAGTGAGGG - Intergenic
1190827231 X:54028769-54028791 GGCTAGAGGTGAATCAGTGATGG - Intronic
1190989854 X:55535982-55536004 GGGCAGGTGTGCATCAGTGAGGG + Intergenic
1197759346 X:130016580-130016602 GGCCAGTGTTCTCTCAGTAAAGG - Intronic
1200749189 Y:6929285-6929307 GGCCAAGGGTAGCTCAGTGCAGG - Intronic
1202232404 Y:22670499-22670521 GGCCTGGGATTTCTCAGTGCAGG + Intergenic
1202310752 Y:23525659-23525681 GGCCTGGGATTTCTCAGTGCAGG - Intergenic
1202560050 Y:26144935-26144957 GGCCTGGGATTTCTCAGTGCAGG + Intergenic