ID: 1126335391

View in Genome Browser
Species Human (GRCh38)
Location 15:47581718-47581740
Sequence AGAAGAACATTGTAGGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126335391 Original CRISPR AGAAGAACATTGTAGGTCAT AGG Intronic
900570533 1:3356070-3356092 AGAAGAACATGAAAGGTCTTGGG - Intronic
900794253 1:4698560-4698582 AGAAGAACCTTCAAGGTCATTGG + Intronic
909239816 1:73198054-73198076 GGAAGAACATTTTAGGTCAAGGG + Intergenic
909737853 1:78987617-78987639 AGAAGAACAAAGTATGTTATTGG + Intronic
911933091 1:103930083-103930105 ATAATAAAATTGTAGATCATAGG + Intergenic
913390058 1:118300581-118300603 AGAAGCAGACTCTAGGTCATTGG + Intergenic
916272233 1:162955606-162955628 AGATCAACACTGTAGGTCACAGG + Intergenic
918498868 1:185171424-185171446 AGAAGAACAATCTACGTGATTGG - Intronic
918907816 1:190521231-190521253 AGAATCACACTGTAGGTTATAGG - Intergenic
920792959 1:209110234-209110256 ACAATAACATAGTAGGTCAGTGG - Intergenic
1064555745 10:16545690-16545712 AGAAGATCTTTGAAGGTCTTTGG - Intergenic
1065793717 10:29285647-29285669 AGAAAAACATTGCAGATGATGGG - Intergenic
1068227654 10:54127130-54127152 AGAAAAACATTTTAAGTCAAAGG + Intronic
1068547391 10:58364063-58364085 AGAAGAACACAGTAGGTACTCGG - Intronic
1068777306 10:60881879-60881901 AAAAGAAGATAGCAGGTCATAGG - Intronic
1069715335 10:70517243-70517265 AGGAGAACATTGTGGGACAAAGG + Intronic
1075596141 10:123730652-123730674 AGCAGAACATTCTATGTCATTGG + Intronic
1077662196 11:4079733-4079755 AGTAGGATATGGTAGGTCATGGG - Intronic
1078653004 11:13213313-13213335 ATAAGAGCTTTGTAGGTCAGGGG + Intergenic
1078852384 11:15176680-15176702 AGAAGAAGATTCAAAGTCATGGG - Intronic
1080163602 11:29210182-29210204 GGAAGAGCCTTATAGGTCATAGG + Intergenic
1080216876 11:29853521-29853543 AGAAGAATTTTGTAGTTGATAGG - Intergenic
1080612820 11:33919426-33919448 AGAAGAACATTTAATGACATAGG - Intergenic
1080716772 11:34810102-34810124 GGAAGAACATTTCAGGTCAAAGG + Intergenic
1085412579 11:76300235-76300257 AGAATAACATTGTAGGTGACAGG - Intergenic
1086664546 11:89463945-89463967 ATAAGAACATTTTAGCTCAAAGG + Intronic
1086729846 11:90235399-90235421 AAAAGACCATTTTAGGTCTTCGG - Intergenic
1087955873 11:104287529-104287551 AGTAGAATTTTCTAGGTCATAGG + Intergenic
1091636874 12:2203716-2203738 AGAAGCACATTGTATCTCCTTGG + Intronic
1092718875 12:11420661-11420683 GGAAGAACATTCCATGTCATGGG + Intronic
1092836721 12:12496894-12496916 AGAAGACCATAAGAGGTCATCGG - Intronic
1093387405 12:18575069-18575091 AGAAGAAAATCCTAGGTCATAGG + Intronic
1093390407 12:18612203-18612225 GGAAGAACATTCTAGGTAAATGG - Intronic
1093651513 12:21651045-21651067 AGAAGAACATTCCAGGTGAAGGG + Intronic
1094050162 12:26211101-26211123 AAAAGCACATTTTAGGTCAAAGG + Intronic
1095544924 12:43355097-43355119 AGAAGAAAACTGTAGGTTCTTGG + Intronic
1098195923 12:68002236-68002258 AAATGCACATGGTAGGTCATGGG + Intergenic
1098928015 12:76374714-76374736 AGAAAGACTTTGTAGGCCATGGG - Intronic
1099645864 12:85355422-85355444 AAAATAACATTATAAGTCATTGG + Intergenic
1100044935 12:90368192-90368214 AGAGGAACAATGTATCTCATGGG + Intergenic
1101499071 12:105284541-105284563 AGAAGAACTTTGTGGTTGATTGG + Intronic
1102750755 12:115291806-115291828 AGGAGAACATTATAGATAATAGG + Intergenic
1103185450 12:118953256-118953278 GGAAGAACAGTGTAGGTGAGAGG - Intergenic
1107266227 13:38558793-38558815 AGTAGATTATTGTAGGTTATTGG + Intergenic
1107660524 13:42634564-42634586 GGAAGCACATTCTAGGACATTGG - Intergenic
1107690380 13:42947709-42947731 AGAAGATCTGTGTACGTCATAGG - Intronic
1109472045 13:62820512-62820534 AGAATAGAATTTTAGGTCATGGG - Intergenic
1111136033 13:84045314-84045336 AGAAAAAATTTATAGGTCATTGG - Intergenic
1112497401 13:99915898-99915920 AGAAGTACATTTGAGGTTATTGG + Intergenic
1112814215 13:103252676-103252698 GGAAGAACATTGTAGGCACTTGG + Intergenic
1115408065 14:33041480-33041502 AGAAGAAAATGGTATGTAATTGG - Intronic
1116135473 14:40917683-40917705 AGAAGAACTTAGTAAGTCATAGG + Intergenic
1116221023 14:42086733-42086755 AGGAAAACATTCTAGGACATGGG - Intergenic
1116428028 14:44813636-44813658 GGGAGAAAACTGTAGGTCATCGG - Intergenic
1120316619 14:82902489-82902511 TGCAGTACACTGTAGGTCATTGG - Intergenic
1123494010 15:20805692-20805714 AGAAGAAGACTGTATGACATTGG + Intergenic
1123550509 15:21374774-21374796 AGAAGAAGACTGTATGACATTGG + Intergenic
1126335391 15:47581718-47581740 AGAAGAACATTGTAGGTCATAGG + Intronic
1128176242 15:65558528-65558550 GGGAGAATATTCTAGGTCATAGG - Intronic
1128581740 15:68815465-68815487 AGAATAACATTTCAAGTCATTGG + Intronic
1129850187 15:78789402-78789424 GGAAAATCATTGTAGGTCTTTGG - Intronic
1129880435 15:79003198-79003220 AGGAGAACATTCTAGACCATGGG - Intronic
1202958852 15_KI270727v1_random:102028-102050 AGAAGAAGACTGTATGACATTGG + Intergenic
1136925270 16:34366319-34366341 ATAAGAACATTTTGGGCCATAGG - Intergenic
1136979304 16:35045487-35045509 ATAAGAACATTTTGGGCCATAGG + Intergenic
1138133830 16:54504410-54504432 GGAAGGACAGTGTAGGTCACAGG + Intergenic
1139274252 16:65712653-65712675 AGTAGAAAATGGTAGGTCAGTGG - Intergenic
1140514508 16:75532339-75532361 AGAAGAACACTTTAGGACCTTGG - Intronic
1151176443 17:72292364-72292386 AGAAGGATATTGTAGGTAATAGG - Intergenic
1153154187 18:2130255-2130277 AGAAGAGCAATTTAGGTCACGGG + Intergenic
1154451537 18:14480156-14480178 AGAAGAAGACTGTATGACATTGG + Intergenic
1156009501 18:32480215-32480237 AGACGCACATTTTAAGTCATAGG + Intergenic
1156216524 18:35004356-35004378 AGAAGAGCAATGTAGGGCTTAGG + Intronic
1157387857 18:47274548-47274570 GAAAGAACATTGTAAGTCAGTGG - Intergenic
1158840991 18:61387196-61387218 AGGACCACATTGTTGGTCATTGG - Intronic
1164326328 19:24195687-24195709 AGAGGGACAGAGTAGGTCATAGG + Intergenic
1166796570 19:45429690-45429712 GGAAGAACATTCTAGGGAATGGG - Intronic
925537540 2:4933630-4933652 GGAGGGACATTATAGGTCATAGG - Intergenic
927018178 2:18989878-18989900 ATAAGAACATTGTTTCTCATGGG - Intergenic
927536672 2:23867097-23867119 GGAAGCACCTTGTAGGTAATGGG - Intronic
930277739 2:49333323-49333345 AGAAGAGCATTGCAAATCATAGG + Intergenic
930685490 2:54302989-54303011 ACAAGAACCCTGTAAGTCATAGG - Intronic
931621088 2:64210526-64210548 AAAAGAAAAGTGTAAGTCATTGG - Intergenic
932949095 2:76271882-76271904 AGAAGAATATAGAAGGACATGGG - Intergenic
933219610 2:79673069-79673091 AGAAGAATATTTAATGTCATTGG - Intronic
934960720 2:98670067-98670089 AGAAGAACATTGTATCAGATAGG - Intronic
937961860 2:127466227-127466249 AGAAGAAAACTGAAGCTCATGGG + Intronic
938480134 2:131655866-131655888 AGAAGAAGACTGTATGACATTGG - Intergenic
939327683 2:140715011-140715033 AGAAGAGCATTGCAGGTAAAAGG + Intronic
940232374 2:151470232-151470254 ATATGAACATTTTGGGTCATGGG + Intronic
940284726 2:152022779-152022801 GCAACAACATTGTAGGTGATGGG - Intronic
940600029 2:155847160-155847182 GGAAGAACATTGCAAGTCAAAGG + Intergenic
942905176 2:181172061-181172083 AGAAGAAAATTTTACTTCATAGG + Intergenic
943194235 2:184722290-184722312 AGAAGAACATTTTAAATCATCGG - Intronic
944604820 2:201343268-201343290 AAATGAACATTTTAAGTCATAGG - Intronic
946541669 2:220690766-220690788 AGAAAATCCTTGTAGGTTATGGG - Intergenic
946817074 2:223590119-223590141 TGTAGAACATTGTAGAGCATGGG + Intergenic
1170858256 20:20077698-20077720 AGAAGAGCCTTCCAGGTCATAGG + Intronic
1170873316 20:20228519-20228541 AGAAGAATATTCTAGATCAGGGG + Intronic
1176444608 21:6810072-6810094 AGAAGAAGACTGTATGACATTGG - Intergenic
1176822774 21:13675110-13675132 AGAAGAAGACTGTATGACATTGG - Intergenic
1177412479 21:20748245-20748267 AAAAGTACATTGTAGGTCAGGGG - Intergenic
1182080103 22:27522679-27522701 AGAACAACATGCCAGGTCATGGG + Intergenic
1183664246 22:39238202-39238224 AGAGGCACATAGTAGGTCCTCGG + Intronic
1184215979 22:43067528-43067550 TGAAGAAGGGTGTAGGTCATGGG - Intronic
949479357 3:4478707-4478729 AGCAGAACAGGGTAGGTCACTGG + Intergenic
952099367 3:29993836-29993858 TGCAGATCATTGTAGATCATGGG + Intronic
952641858 3:35605949-35605971 AGAAGACCTTTGTATGTCAGTGG - Intergenic
953074986 3:39560609-39560631 AGAACAAAATTGAAGGTCCTTGG - Intergenic
954807805 3:53230445-53230467 AGCAGAACATGGTAGGTGCTGGG - Exonic
955690853 3:61589415-61589437 AGAAGACCCTTGTATCTCATGGG - Intronic
958840501 3:99198686-99198708 TTAAGAACATTGTGGTTCATGGG - Intergenic
963380780 3:144527140-144527162 GGAGGAAGATTGTAGGTCACAGG + Intergenic
963438655 3:145307469-145307491 AGGAGAATATTTTAGTTCATTGG + Intergenic
965731756 3:171779437-171779459 TGAGGAACATTGTAGGTGATGGG + Intronic
965882318 3:173400585-173400607 AGAAAAACATTTTAGTTCCTTGG + Intronic
969966984 4:11007087-11007109 TGAAGAACTCTGCAGGTCATGGG + Intergenic
970387244 4:15568078-15568100 AGGAAAGCAGTGTAGGTCATTGG - Intronic
970546665 4:17137350-17137372 AGAAAAACATTGAAGATGATAGG + Intergenic
972124817 4:35750446-35750468 ACATGAACATTGCAGGTTATGGG + Intergenic
972130440 4:35826346-35826368 ACAAGAAGATTGCAGGTAATGGG + Intergenic
972520834 4:39854456-39854478 GGAAGAATATTGGAGGTCAAAGG - Intronic
974600832 4:64077053-64077075 AAAAGATCATTGTTGGTGATGGG - Intergenic
975480507 4:74874559-74874581 AGAAGAACATTTAATGACATGGG - Intergenic
975491470 4:74993792-74993814 AGAAAACCTTTGTAGGTGATGGG + Intronic
976480388 4:85536871-85536893 ATATCAACATTTTAGGTCATAGG + Intronic
976533619 4:86185406-86185428 AGAAGAACATTTTAGGATAGAGG + Intronic
977228898 4:94428027-94428049 AAAAGTATATTGTAGGTCCTTGG + Intergenic
977978153 4:103291431-103291453 AGAAGCCCATTGTAGCTCAGAGG + Intergenic
978132278 4:105213601-105213623 AGAAGAACATCCTAGGTAAAGGG - Intronic
978708843 4:111752141-111752163 ATCAGAATATTGTAGGTAATAGG + Intergenic
979793835 4:124819131-124819153 AGAATAACATAGTTGGTCATAGG - Intergenic
979866765 4:125765379-125765401 ACAAAAACATAGTAAGTCATTGG - Intergenic
980570455 4:134609982-134610004 AAAAGCACATTGGAGGTAATTGG - Intergenic
985254392 4:188055444-188055466 AGAAGAATAATGTAGGTAAAGGG - Intergenic
985714888 5:1450570-1450592 AGAACAACATTGGAGGACCTAGG + Intergenic
986197652 5:5552826-5552848 GGAAGGACATTGTAAATCATGGG + Intergenic
986217421 5:5732561-5732583 ATAGGTACATTGTATGTCATGGG + Intergenic
987101922 5:14598463-14598485 AAAAGAAAATTCTAGGTCACAGG - Intronic
988083906 5:26447851-26447873 AGAAGAAAATAGCAGGGCATGGG - Intergenic
988129904 5:27090694-27090716 AGAAGAAAATTGAAGTTCAATGG - Intronic
988283778 5:29185819-29185841 AGACAAACATTGGAGTTCATGGG - Intergenic
988932141 5:36047149-36047171 AGAAGGGGATTCTAGGTCATAGG - Intronic
992816243 5:80442511-80442533 AGAAGAACATTCTAGGCCAAGGG + Intronic
993257301 5:85607716-85607738 ATAATAACATTGTATGTAATTGG + Intergenic
994655249 5:102584913-102584935 AGAAGAAAATTATAGATCAAAGG - Intergenic
995454949 5:112341074-112341096 AGAAAAACAAAGTAGGTGATGGG - Intronic
996241163 5:121204139-121204161 AGAATAACATTCTGGGTCTTAGG - Intergenic
997846722 5:137293121-137293143 TGATGCACATTGTAGGCCATTGG + Intronic
999476225 5:151901296-151901318 AGAATAACACTGAAGGTCAGAGG - Intronic
999537169 5:152529798-152529820 TGGAGAACTTTGTAGGTCATTGG + Intergenic
1000538680 5:162511581-162511603 AGAAGAAAATTGGTGGTGATGGG - Intergenic
1004106842 6:12673760-12673782 ATAAGAACCTTGTACTTCATCGG + Intergenic
1006415590 6:33901903-33901925 AGGAGCACATTGGAGGTAATGGG + Intergenic
1007064689 6:38977844-38977866 AGAAGACAATTGTAGATAATTGG - Intronic
1009432067 6:63574741-63574763 TAAAGATCATTGTATGTCATTGG + Intronic
1009485386 6:64215959-64215981 AAAAGAACATTGGCGGGCATGGG + Intronic
1010466419 6:76171871-76171893 AGAAGTAAATTGCATGTCATGGG - Intergenic
1012785829 6:103624563-103624585 AGAATAAGATTGTAGCTCAGGGG + Intergenic
1012835421 6:104258819-104258841 AGAAGATCTTTGTAGCTCAATGG - Intergenic
1016386900 6:143537548-143537570 AGAGGAACATTCTCGGTCTTCGG + Intronic
1019041005 6:169105463-169105485 AGAAGAATATTTTAGGTAAGTGG + Intergenic
1023318976 7:38973405-38973427 AGAAGAAAACTGTAAATCATAGG + Intergenic
1024661759 7:51502040-51502062 TGAAGAACATTGTAGCTTTTAGG + Intergenic
1024875458 7:54017566-54017588 ACAAACACATTGTAGGTTATAGG + Intergenic
1030938124 7:115611924-115611946 AGACAAACATTGCAGATCATTGG + Intergenic
1031844507 7:126788551-126788573 AGAATCACATTCTAGGGCATAGG - Intronic
1033758230 7:144414627-144414649 GGAAGGACATTGTAATTCATGGG - Intergenic
1035329496 7:158087041-158087063 AGACAAACATTGCAGGGCATTGG + Intronic
1038106182 8:24437301-24437323 ATAAGAGCATTCTAGGTGATGGG + Intergenic
1041500549 8:58534451-58534473 AGAAGCTCATTGTAGGACATGGG + Intergenic
1041527829 8:58827559-58827581 AGAAAAACACTGGATGTCATGGG + Intronic
1042720895 8:71825995-71826017 AGTATAACATTGTTGGACATTGG - Intergenic
1043481821 8:80660851-80660873 AGAAAAACACTCTAGGACATGGG + Intronic
1047548977 8:125849086-125849108 AGAGGAAAATTGTAGGTTTTGGG + Intergenic
1050478980 9:6070134-6070156 AGAGGAAGACTGTAGGTCCTGGG - Intergenic
1051211058 9:14744764-14744786 AGTAGAATATGTTAGGTCATAGG + Intronic
1051896178 9:21991409-21991431 AGTAGAACACTGTAGGCCAGGGG - Intronic
1052443367 9:28527270-28527292 AGAAGAAAATGGGAGGTTATGGG - Intronic
1052522814 9:29571405-29571427 AGCAGAACATCGTATGTGATTGG - Intergenic
1054970812 9:71084104-71084126 ATTAGCACATTGTAGGTCCTTGG - Intronic
1056499713 9:87196963-87196985 ATAAAAACATAGCAGGTCATTGG + Intergenic
1058249363 9:102671938-102671960 ATAAGAAAATTGTGGCTCATAGG - Intergenic
1059688848 9:116664160-116664182 AGAATAATATTGTATGTGATTGG + Intronic
1059940820 9:119358044-119358066 ATGAGAACATTGTGGGTCAGAGG - Intronic
1203524590 Un_GL000213v1:74455-74477 AGAAGAAGACTGTATGACATTGG + Intergenic
1186437921 X:9559224-9559246 AGAAGATCATGGTAGGACAAAGG - Intronic
1187763929 X:22618716-22618738 AGAGGTACATTCTAGGTGATCGG - Intergenic
1188153752 X:26714812-26714834 AGAAACACATTGCTGGTCATGGG - Intergenic
1188277355 X:28216651-28216673 ATAAAAACATTCTAGGTCACAGG + Intergenic
1188461021 X:30427299-30427321 TGAAGAACCTTGTAGGTATTGGG + Intergenic
1189074011 X:37897079-37897101 AGAAGAACATGGTAGGCAAAAGG + Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189124922 X:38436104-38436126 AGCAAAACAATGTAGGTCCTAGG + Intronic
1189465930 X:41277349-41277371 AGAAGGACGTTATAGGTCATGGG - Intergenic
1191930122 X:66363178-66363200 AGAATAACACTTTAGGGCATTGG - Intergenic
1194317690 X:92400971-92400993 TTAAGAACATTGTGGCTCATTGG + Intronic
1194461617 X:94176708-94176730 AGAAGTACATGGTGGGTAATAGG - Intergenic
1198700704 X:139395393-139395415 GGCAGAACATTGTAGGCTATTGG - Intergenic
1200625867 Y:5514253-5514275 TTAAGAACATTGTGGCTCATTGG + Intronic