ID: 1126336515

View in Genome Browser
Species Human (GRCh38)
Location 15:47591149-47591171
Sequence TTGCTGCATCCTCATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126336511_1126336515 1 Left 1126336511 15:47591125-47591147 CCCTGCTTCATAAATGGCACTTT 0: 1
1: 0
2: 7
3: 33
4: 284
Right 1126336515 15:47591149-47591171 TTGCTGCATCCTCATGAGGTGGG 0: 1
1: 0
2: 1
3: 33
4: 270
1126336512_1126336515 0 Left 1126336512 15:47591126-47591148 CCTGCTTCATAAATGGCACTTTG 0: 1
1: 0
2: 1
3: 43
4: 368
Right 1126336515 15:47591149-47591171 TTGCTGCATCCTCATGAGGTGGG 0: 1
1: 0
2: 1
3: 33
4: 270
1126336509_1126336515 27 Left 1126336509 15:47591099-47591121 CCAACAGGTGCAGGTGAGGACTT 0: 1
1: 0
2: 0
3: 16
4: 136
Right 1126336515 15:47591149-47591171 TTGCTGCATCCTCATGAGGTGGG 0: 1
1: 0
2: 1
3: 33
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126336515 Original CRISPR TTGCTGCATCCTCATGAGGT GGG Intronic
900199147 1:1395389-1395411 GTGAAGCATCCTCATAAGGTGGG - Exonic
900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG + Intronic
900852575 1:5155689-5155711 TTGCTGCATCCTCCAGAGGAAGG + Intergenic
903689188 1:25158846-25158868 TTTCTGAATACTAATGAGGTTGG - Intergenic
904688530 1:32276688-32276710 TTGCAGCTGCTTCATGAGGTTGG - Exonic
905252150 1:36656426-36656448 CTGCTGCATCAGCATGAGGCTGG + Intergenic
907052164 1:51336794-51336816 TTGCAACAACCTAATGAGGTTGG - Intronic
909973576 1:82020178-82020200 TTGCCGTATCCTGGTGAGGTAGG - Intergenic
910648375 1:89537821-89537843 TTGCTGTATCCTCACATGGTGGG - Intronic
911182446 1:94873222-94873244 GTGCTGCATCCCCTTGAGGAGGG + Intronic
913253415 1:116931629-116931651 TTGCTGCATTTTCATGACTTAGG + Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
919132448 1:193468460-193468482 ATGCTGCATCCTCCAGAGGCAGG + Intergenic
920971936 1:210750224-210750246 TTGCTACAACTTTATGAGGTTGG - Intronic
922474825 1:225899506-225899528 CTGTTGCATCCTCAGGAGGGAGG - Intronic
922775203 1:228211358-228211380 TTGCTGCACCTTCCTGAGGCAGG - Intronic
924291412 1:242540406-242540428 TTGCTGCATTGTAATGAAGTAGG - Intergenic
924491660 1:244544146-244544168 TGGCTGCATCCTCTTCAGGAAGG + Intronic
1063101612 10:2954773-2954795 TTCCTGGATCCTTCTGAGGTGGG + Intergenic
1064481150 10:15742058-15742080 TTACTGCATCCTCAAGTGGTTGG - Intergenic
1066491840 10:35901626-35901648 TTAATGCAACCTTATGAGGTGGG - Intergenic
1067552534 10:47245732-47245754 CAGCTTCATCCTCATGAGGGTGG - Intergenic
1069375225 10:67786603-67786625 TTGCTGCATCCTTAGGTGGGAGG + Intergenic
1069827701 10:71264210-71264232 TTGCAGCAATCTTATGAGGTTGG - Intronic
1070614802 10:77961480-77961502 TGACTGCAGCCTCACGAGGTGGG + Intergenic
1071683961 10:87735442-87735464 TTACTGCATCCTCAGGGGTTTGG + Intronic
1071769968 10:88717448-88717470 TTGCAACAACCTCATGAGGAAGG + Intergenic
1072392709 10:95004460-95004482 TTGCAGCAACCTGATGAGATTGG - Intergenic
1072528346 10:96294864-96294886 TTGCTGTATCCTCACATGGTGGG - Intergenic
1073141628 10:101252308-101252330 TTGCTGCATCCTTATGTCGGGGG + Intergenic
1075529648 10:123218556-123218578 TTGTTGCAGCCTGATGAGGGTGG + Intergenic
1075795177 10:125115095-125115117 CTGCTGCCTCCTCTTGAGGCTGG + Intronic
1076441378 10:130483538-130483560 TTGCTCCAGCCTCATGGGATGGG + Intergenic
1076671053 10:132121288-132121310 TTGCTGGAGCCCCATGAGCTGGG - Intronic
1079340094 11:19604628-19604650 TTGTAGCAGCCTCATGAGATGGG + Intronic
1080130331 11:28787015-28787037 TTGCTGCATCCTGGTGATTTTGG + Intergenic
1080205617 11:29725633-29725655 CCGCTGCATCCTCATGTGGCAGG - Intergenic
1080267735 11:30419189-30419211 TCGCAGCAAACTCATGAGGTGGG + Intronic
1080943082 11:36941129-36941151 TCATTGTATCCTCATGAGGTGGG + Intergenic
1081616503 11:44594569-44594591 TTGCAGCAACCCCAGGAGGTGGG - Intronic
1083031836 11:59599671-59599693 TAGCTGCATCCTCAAGAAATGGG + Intronic
1083700298 11:64472964-64472986 TTGCTGTGTCCTAATGAAGTAGG + Intergenic
1084509053 11:69591621-69591643 TTGCTGTGTCCTCATGTGGCTGG - Intergenic
1084944150 11:72629848-72629870 TTACAGCACCCCCATGAGGTAGG - Intronic
1085803917 11:79617294-79617316 TTCCTGCATCTGCATGAGGAAGG - Intergenic
1086668379 11:89514125-89514147 TTGCTTCATGATCATGGGGTGGG + Intergenic
1087922593 11:103883579-103883601 ATTCTTCATCCTCATGAAGTGGG + Intergenic
1088747875 11:112819717-112819739 TTTCTGCATCCTCAAGGGGCAGG - Intergenic
1090253907 11:125269796-125269818 TTGGTACATCCTCACGGGGTCGG + Intronic
1095227839 12:39698251-39698273 GTGCTCCATCCTCATGAAGGGGG + Intronic
1095931614 12:47631963-47631985 TTGCTGCTTCTTCATATGGTGGG + Intergenic
1096502366 12:52072230-52072252 TTGCTCCATGCTCATGATCTTGG - Intronic
1097539204 12:60915626-60915648 TTGCTACATCCCCAAGAGTTGGG - Intergenic
1099156881 12:79188515-79188537 TTATTGCATCCTCATGGAGTTGG + Intronic
1100096257 12:91041310-91041332 TTGCTGCATTCTCCAGAGGAGGG + Intergenic
1100363778 12:93900764-93900786 TTGCAGCATCTCCATGAGCTAGG - Intergenic
1101114580 12:101519534-101519556 TTGCTCTGTCCTCAAGAGGTGGG + Intergenic
1101241189 12:102841547-102841569 TTGCTGCAACCCCCTGAGGCAGG - Intronic
1102792034 12:115654868-115654890 TTACAGCAACATCATGAGGTAGG - Intergenic
1104464334 12:128978432-128978454 GTGCGGCATCGTCCTGAGGTCGG + Intronic
1105789800 13:23787344-23787366 TTGCTGCATCCTCACATGGTAGG + Intronic
1106110927 13:26776222-26776244 TTGCTGCATCATCCTGTGGTGGG - Intergenic
1106130244 13:26933708-26933730 TTGCTGTGTCCTCATGGGGTGGG - Intergenic
1106475340 13:30093530-30093552 TTGCTGTGTCCTCACAAGGTAGG - Intergenic
1106937214 13:34736224-34736246 TTGCTGCATCATCAGGCGGCGGG + Intergenic
1107336802 13:39364022-39364044 TAGCTCCATCCTCATCTGGTGGG + Intronic
1107543978 13:41419775-41419797 TTAATGCATCCTCCTGAGGGTGG - Intergenic
1111804985 13:93029900-93029922 TTGCTGTATTCCCAGGAGGTTGG - Intergenic
1112096914 13:96143819-96143841 TAGCAGCATCCTAATGGGGTTGG + Intronic
1113026519 13:105946710-105946732 TTGCTGTAACCTCATGTGGTGGG + Intergenic
1114492245 14:23110440-23110462 TTTCAGCCACCTCATGAGGTAGG + Intergenic
1115002579 14:28440208-28440230 TTGCTGCAGCCTTAGGAAGTAGG + Intergenic
1115106921 14:29772342-29772364 TAGCTGCATCCTCACTTGGTGGG - Intronic
1116380161 14:44257899-44257921 TTGCTGCATCATCCTGATTTTGG + Intergenic
1116422696 14:44751640-44751662 TTGCTGCATCCTCACATAGTGGG + Intergenic
1116637445 14:47415815-47415837 CTGCTGCATCCTCACATGGTGGG + Intronic
1119126233 14:72129852-72129874 GTGGTGCCTCATCATGAGGTGGG - Intronic
1119130235 14:72165357-72165379 TAGTTGCATCATCATGAGGAAGG + Intronic
1119968944 14:78947990-78948012 TTACAGCAACCGCATGAGGTAGG - Intronic
1120225095 14:81782001-81782023 TTGCTCTCTACTCATGAGGTCGG - Intergenic
1121336274 14:93079366-93079388 CTTCTGCAGCCTCATGAGGGTGG + Intronic
1122185260 14:99987702-99987724 TTGCTGCATCCTCACATGCTAGG - Intronic
1122285180 14:100647072-100647094 TTGCTGTATCCTCACGTGGTGGG - Intergenic
1202839060 14_GL000009v2_random:103487-103509 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1202908427 14_GL000194v1_random:93578-93600 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1126153100 15:45540831-45540853 TGGCTGTATACTCAGGAGGTTGG - Intergenic
1126251662 15:46574640-46574662 TTGATTCAGCCTCATGAGGCTGG - Intergenic
1126336515 15:47591149-47591171 TTGCTGCATCCTCATGAGGTGGG + Intronic
1127918297 15:63473338-63473360 TGGCTCCATCTTCATGAAGTTGG - Intergenic
1128239960 15:66095144-66095166 ATGCTGCAGCCTCCTGAGGTGGG + Intronic
1128262834 15:66244415-66244437 TTGCTGCATCCCCAGGACTTTGG - Intronic
1131275301 15:90975439-90975461 TTACAACATCCTTATGAGGTCGG - Intronic
1134922838 16:18132646-18132668 GTACTTCATCCTCCTGAGGTCGG + Intergenic
1135387594 16:22057310-22057332 ATGCTGCATCCTCCTGAGGGAGG + Intronic
1137932868 16:52605078-52605100 TTGCAGTAACCTCATGAAGTAGG - Intergenic
1138418044 16:56882514-56882536 TGGGTGCCTCCTCCTGAGGTGGG - Intronic
1139205686 16:65026263-65026285 CTGCAGCATCTTGATGAGGTGGG + Intronic
1139647221 16:68340209-68340231 TGGCTGCATCATGATGAGGCGGG - Intronic
1141160777 16:81627970-81627992 TGGCTGCACCCTCAGGAGGGCGG + Intronic
1141195098 16:81854381-81854403 TGGCTGCATCCTCAGGTGGAGGG + Intronic
1141289546 16:82704977-82704999 TTGCTGCTGCCTCATGAGGAAGG + Intronic
1143362469 17:6383043-6383065 TTGCTGCATCCACAGGGGGCTGG + Intergenic
1143410601 17:6706246-6706268 TTTCTGCTTCCCCATGAGCTGGG + Intronic
1145759053 17:27415562-27415584 TGGCTGCTTCCTCAAGAGGAGGG - Intergenic
1146092471 17:29893516-29893538 TTGCTGCATCCTCATGTAGAAGG - Intronic
1146647626 17:34585520-34585542 TTTCCTCATCCACATGAGGTTGG - Intronic
1146845322 17:36178676-36178698 TGGCTGCTTCCTCAAGAGGAGGG + Intronic
1146873538 17:36390519-36390541 TGGCTGCTTCCTCAAGAGGAGGG + Intronic
1146880896 17:36441607-36441629 TGGCTGCTTCCTCAAGAGGAGGG + Intergenic
1147065851 17:37922354-37922376 TGGCTGCTTCCTCAAGAGGAGGG - Intergenic
1147438442 17:40432047-40432069 GTGATGCCTCCTCATGTGGTGGG + Intergenic
1148757336 17:49980515-49980537 GTGCTCCAACCTCATGATGTGGG - Intergenic
1149313501 17:55418834-55418856 TAGCTGCATGATCATGAGGTTGG + Intronic
1151180575 17:72324703-72324725 TCCCTACAACCTCATGAGGTAGG + Intergenic
1153294106 18:3529266-3529288 TTGCTGCAGCCTCACGATGGAGG - Intronic
1153890284 18:9507861-9507883 TTGCTGTGTTCTCATGTGGTGGG + Intronic
1153968542 18:10203715-10203737 TTGCTGTGTCCTTATGTGGTTGG - Intergenic
1154506797 18:15048583-15048605 TTGCTGCTTCCTCAGAAGGGAGG + Intergenic
1155016618 18:21847575-21847597 TTGCTTCATCCTCAGTAGCTGGG + Intronic
1155324142 18:24649253-24649275 TTGCTGCATCCTCTGGAGGGAGG + Intergenic
1157176086 18:45453718-45453740 TCACTGCATCCACATGAGGTAGG + Intronic
1157329304 18:46691921-46691943 TTGCAGCAGCCTTGTGAGGTTGG - Intronic
1159220845 18:65461333-65461355 TTGCTGCATCCTTACTTGGTGGG + Intergenic
1159381756 18:67668987-67669009 TTGCTGTGTCCTCATACGGTGGG - Intergenic
1159415698 18:68145702-68145724 TTGCTGTATCCTCACACGGTAGG + Intergenic
1159651994 18:70988500-70988522 TTGCTGCATCCTCTGGAGGGAGG + Intergenic
1159847982 18:73489341-73489363 TTGCTGCATCCTCACATGGCGGG + Intergenic
1161218258 19:3105503-3105525 TTGCTGTGTCCTCATGCGGACGG + Intronic
1163207604 19:15815016-15815038 CTCCTGCTGCCTCATGAGGTAGG - Intergenic
1164916295 19:32054877-32054899 CTGCTGCATCCTCTGGAGGGAGG + Intergenic
1168190835 19:54737879-54737901 ATGCAGCATCCTCATGAGAGGGG - Intronic
1168205762 19:54849809-54849831 ATGCAGCATCCTCATGAGAGGGG - Intronic
1168208185 19:54868136-54868158 GTGCAGCATCCTCATGAGAGTGG - Intergenic
1202633976 1_KI270706v1_random:27069-27091 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1202651904 1_KI270707v1_random:12944-12966 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
925258382 2:2508721-2508743 TTTCAGCAACCTGATGAGGTTGG - Intergenic
926633234 2:15156537-15156559 TTGCTGCATCCTCACATGGTGGG + Intergenic
927640236 2:24841278-24841300 CTGCTCCATCCTCATGGGGCTGG - Exonic
932166796 2:69515156-69515178 TTGCTTCATCCTGTTCAGGTAGG - Intronic
932538968 2:72630870-72630892 TTGCTACTTCCTCCTGAGATTGG - Intronic
935099435 2:99978776-99978798 TTGCTGTATCCTCACGTGGTGGG - Intronic
935368282 2:102317929-102317951 TTGCTGCAACACCCTGAGGTGGG + Intronic
935799741 2:106682519-106682541 ATGCTGCATCCTCACGGGGTAGG - Intergenic
935898891 2:107769283-107769305 ATCCAGCATCCTCATGAGGAAGG + Intergenic
937908855 2:127065642-127065664 TGGCTGCATCCTCATGGAGAGGG - Intronic
937933922 2:127227284-127227306 TCGCTGTGTCCTCATGTGGTGGG + Intergenic
938841452 2:135168818-135168840 GTGCTGCCTCCTCCTGAGGGAGG + Exonic
940822683 2:158374566-158374588 TTGCAGCATCCTCTTCAGTTTGG - Intronic
941033837 2:160544393-160544415 TTGCTGCATCCTCACATGGTAGG - Intergenic
941091603 2:161182826-161182848 TTGCTGCATACTCTGGAGGAAGG - Intronic
941436887 2:165483741-165483763 TTGCTGTAACCTCATGTGGCAGG + Intronic
944182649 2:196912081-196912103 TTACTGCAGTCCCATGAGGTAGG - Intronic
944936926 2:204579246-204579268 TTGCAGCAATCTCATGGGGTTGG + Intronic
947619321 2:231578548-231578570 TTCCAGCATCTTCATGAGGCAGG - Intergenic
947665639 2:231903853-231903875 ATGCTGCATCCTCTAGAGGGAGG + Intergenic
947677659 2:231998243-231998265 TTGCTGCATCATCCTGTGGTGGG + Intronic
948675918 2:239596637-239596659 TTCCTCCTTCCTCATGAGGTAGG - Intergenic
1168761481 20:353089-353111 TTGATCCATCCTCAGGAGATGGG - Intronic
1168955441 20:1831352-1831374 TTACTTCAGCCTCATGAGGGAGG - Intergenic
1169848161 20:10018668-10018690 TTACTTCATACTCATGAGGATGG - Intronic
1170668876 20:18411891-18411913 TTGCTGCATCCTCCAAAGGAGGG + Intronic
1170793452 20:19526371-19526393 CTTCTTCATCTTCATGAGGTAGG - Intronic
1172062063 20:32193443-32193465 TCTCTGCATCATCTTGAGGTGGG - Exonic
1172134466 20:32677729-32677751 TTGATACATGCTTATGAGGTGGG - Intergenic
1174080415 20:47967405-47967427 TTGCTGCATTGTCATAAGGATGG + Intergenic
1175291401 20:57878152-57878174 TTGCTGCAGCGTCCTGAGGCTGG - Intergenic
1175973604 20:62699317-62699339 TTGCCGCGTCCTCCTGCGGTGGG - Intergenic
1176627786 21:9108241-9108263 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1176646189 21:9352850-9352872 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1176871564 21:14086783-14086805 TTGCTACATTCTCATGATGATGG - Intergenic
1177500591 21:21949766-21949788 TTGCTGTACCCTCATGTGGTAGG - Intergenic
1177990719 21:28032851-28032873 TTGCTGCTTCCTCAGAAGGGAGG + Intergenic
1180100980 21:45585610-45585632 TTGCTACATCCTGAAGAGATGGG - Intergenic
1180366726 22:11946147-11946169 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1180379356 22:12125059-12125081 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1180418127 22:12787828-12787850 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1182920923 22:34077956-34077978 TTGCTGTATCCTCATTTGGTGGG - Intergenic
1184966025 22:47972900-47972922 TGGCTGCGTCCTCATGTGGGGGG + Intergenic
1185328929 22:50242967-50242989 TGGCTGCATTGTCCTGAGGTGGG - Intronic
949742618 3:7253651-7253673 TCACAGCATCCTTATGAGGTAGG + Intronic
950268049 3:11589769-11589791 TTGCTGTGTCCTTATGTGGTGGG + Intronic
950367814 3:12500719-12500741 TTGCTGCAACCCCAGGAGGTAGG + Intronic
950401870 3:12775285-12775307 TTCCAGCATCCTGCTGAGGTGGG + Intergenic
950478720 3:13231440-13231462 TTGCTGCAGCCTCACATGGTGGG + Intergenic
950531739 3:13556296-13556318 TTGCTGTGTCCTCACAAGGTGGG + Intronic
950546384 3:13640436-13640458 TTGCTACATCCTGAGGAGGCTGG + Intergenic
953019488 3:39104560-39104582 TTGCTGCCTCCTCATGGGAAAGG + Intronic
953505674 3:43483776-43483798 TTGGTTCATCCTAAAGAGGTAGG + Intronic
953848321 3:46446160-46446182 TTTCCTCATCCCCATGAGGTGGG + Intronic
956490764 3:69769254-69769276 TTGCCACATCCTTATGAGGTAGG - Intronic
956564975 3:70626022-70626044 TTGCTGCATCCTCCAGAGTGGGG - Intergenic
956875387 3:73457798-73457820 TTGCTGCATCCTCACATGGTGGG - Intronic
957093997 3:75760516-75760538 TTGTTGCCTCCTCCTGAGTTTGG - Intronic
958576777 3:95960009-95960031 TTGCTGTATTCTCATATGGTGGG - Intergenic
961440026 3:126947249-126947271 CTGCAGCATCAACATGAGGTGGG - Intronic
961539837 3:127591763-127591785 TGGCTCCATCCTCATGACGCTGG - Intronic
962937100 3:140091126-140091148 TTACAGCAGCTTCATGAGGTTGG - Intronic
962998148 3:140651603-140651625 TAGCTGCCTCCTCATGGGGCAGG + Intergenic
963028721 3:140945161-140945183 TTGCTGTATCCTCACGTAGTAGG + Intronic
965660474 3:171036639-171036661 TTGCTACAGCCTCATGAGGGTGG + Intergenic
1202740695 3_GL000221v1_random:52206-52228 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
969567656 4:7988374-7988396 TTGCTGCAACTCCAGGAGGTGGG + Intronic
970213614 4:13736051-13736073 TTTCAGCAACCTTATGAGGTAGG + Intergenic
970281660 4:14463434-14463456 TTGCTTCTTCCTTATGAGGCTGG + Intergenic
970311800 4:14790245-14790267 TTGCTGCATCCTAAAGATTTTGG - Intergenic
973032852 4:45365623-45365645 TTGCTGCATCCTCTTGGGGGAGG + Intergenic
973135494 4:46700809-46700831 TTTCTGCTTCATCATGAGGGAGG - Intergenic
973363662 4:49189461-49189483 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
973397418 4:49607280-49607302 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
974031372 4:56779696-56779718 TTGATGCATCCTGGTGCGGTCGG - Intergenic
974977573 4:68909525-68909547 TTTCAGCAACCCCATGAGGTCGG + Intergenic
976138601 4:81965711-81965733 TTGCAACAACCTAATGAGGTGGG - Intronic
976191460 4:82491062-82491084 TTGCTGCATTATCAAGAGGAAGG - Intronic
976367568 4:84247219-84247241 TCTCTGCATCATCTTGAGGTGGG + Intergenic
978300510 4:107264783-107264805 TCTCTGGAACCTCATGAGGTAGG - Intronic
978932041 4:114326008-114326030 TTGCTGCATCCTTATGTGACAGG - Intergenic
979790917 4:124780308-124780330 TTTCTGCTTGCTCATGAGTTTGG + Intergenic
981052375 4:140321992-140322014 TTGCTGCATCCTCACATGGCAGG - Intronic
981400059 4:144303360-144303382 TTGCTGCTTATCCATGAGGTTGG + Intergenic
983258682 4:165431601-165431623 TTGCTGCTTCCTGATGAGTTTGG + Intronic
983956606 4:173705466-173705488 TTGCTGCATCCTCGTGTGAAGGG - Intergenic
984982623 4:185297711-185297733 TTGCTATATCCTCACGTGGTAGG + Intronic
985329623 4:188816805-188816827 TTTATGCATGCTCATGAGGTAGG + Intergenic
1202760976 4_GL000008v2_random:110542-110564 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
985926204 5:3020960-3020982 TTTCTGCATCCCCAGGAGGGAGG - Intergenic
987416861 5:17671078-17671100 TCTCTGCATCATCCTGAGGTGGG + Intergenic
987741888 5:21919794-21919816 ATGCTGAATCCTCATGCGGCAGG - Intronic
988318959 5:29668578-29668600 TTGCAGCCTCCTCATGAGTAAGG + Intergenic
990167387 5:53009807-53009829 TTGTTGCATCCTCACAAGGCAGG - Intronic
991281097 5:64914534-64914556 TTCCTGAATACTCATGAAGTTGG - Intronic
991632375 5:68669264-68669286 GTCCTTCAGCCTCATGAGGTGGG - Intergenic
992433683 5:76734399-76734421 TTGCTCCATCCTCCTGGGATTGG + Exonic
993089455 5:83406797-83406819 TTACAGCAACCTTATGAGGTAGG + Intergenic
996613865 5:125415869-125415891 TCACAGCATCCTTATGAGGTAGG + Intergenic
997553034 5:134770324-134770346 TTTCTGCCTCCTCAGTAGGTAGG + Intronic
997820650 5:137062841-137062863 TTGCTTCATACTCTTGAGGCTGG + Intronic
1000253264 5:159514832-159514854 TTGCTGCAGCCTCCTGAGCCAGG + Intergenic
1000843910 5:166255336-166255358 TTGCTACAACTTCATGAGATAGG + Intergenic
1001971532 5:175958793-175958815 TTGCAGCAGCCTTCTGAGGTGGG - Intronic
1002008658 5:176258283-176258305 TCACTGCAACCCCATGAGGTAGG + Intronic
1002218063 5:177653968-177653990 TCACTGCAACCCCATGAGGTAGG - Intergenic
1002245910 5:177884983-177885005 TTGCAGCAGCCTTCTGAGGTGGG + Intergenic
1002398611 5:178977344-178977366 TTGCTGTGTCCTCATATGGTGGG - Intergenic
1003019219 6:2495786-2495808 TTGCTGTGTCCTCATGTGGATGG + Intergenic
1004685815 6:17942492-17942514 TTGCTGCAACTTTATGAGGTAGG - Intronic
1004764416 6:18709359-18709381 TTGGTGCATCCTCACATGGTGGG + Intergenic
1006788314 6:36682602-36682624 CTGCTGAGTCCTCATGAGGCAGG - Intronic
1008832328 6:55780766-55780788 TTCCTGGACCCTCATGAGCTTGG - Intronic
1011016958 6:82767572-82767594 TTGCTTCAGCATCAGGAGGTGGG + Intergenic
1011656501 6:89556801-89556823 TTGCAACAACCTAATGAGGTAGG + Intronic
1012043976 6:94245581-94245603 CTGCTGGATCCTCATGTGGCAGG + Intergenic
1013015953 6:106160786-106160808 ATACTGTGTCCTCATGAGGTTGG - Intergenic
1017173023 6:151475721-151475743 TTGCTGCATCTTCTGGAGGAGGG + Intergenic
1020540484 7:9456862-9456884 TTGCTGCATCCCAATGATTTTGG + Intergenic
1023036875 7:36138841-36138863 CTGCCCCATCCTCATGGGGTTGG + Intergenic
1023461506 7:40402761-40402783 TTGCTTCATCCTGATCGGGTAGG + Intronic
1025024289 7:55503740-55503762 TTGTTCCATCCTCACGTGGTGGG - Intronic
1026075119 7:67159185-67159207 TTGCTGCATATTCATTAGTTGGG + Intronic
1026701732 7:72652988-72653010 TTGCTGCATATTCATTAGTTGGG - Intronic
1029610137 7:101622383-101622405 TTGCTCCCTTCTCATGAGGCTGG - Intronic
1029968679 7:104767656-104767678 TTGCAACTTCCTCAAGAGGTAGG + Intronic
1030625585 7:111842513-111842535 TCACTACATCCTCATGAGGGTGG - Intronic
1031016167 7:116578928-116578950 CTGCTGTGTCCTCATGTGGTAGG + Intergenic
1033475336 7:141686889-141686911 ACGCAGCATCCTCATGAGGGAGG - Intronic
1034527970 7:151678104-151678126 CTGCTCCATCCTCATGGGGAAGG + Intronic
1037419320 8:18685371-18685393 TTGTTGCATCCTCATGACAGGGG + Intronic
1038330017 8:26600896-26600918 TTTCTGCTTCCTGATGGGGTGGG + Intronic
1038751254 8:30298045-30298067 ATGCTGCATCCTCTGGAGGGAGG - Intergenic
1040637689 8:49294583-49294605 CTTCTGCTTCCTCATGTGGTTGG - Intergenic
1041090229 8:54295077-54295099 TTGTTGTATTCTCATGGGGTGGG - Intergenic
1042343547 8:67704873-67704895 TGGATGCATCCTCAAGAAGTGGG + Intronic
1042579908 8:70265254-70265276 TTGCTGCATCCTCACATGGCAGG - Intronic
1042984942 8:74573363-74573385 TTGTTGTATCCTCATATGGTGGG + Intergenic
1043164136 8:76882329-76882351 TTGCTCTATCTTCTTGAGGTGGG + Intergenic
1044796649 8:95907493-95907515 TTGCTGCAAACACATTAGGTTGG - Intergenic
1045714120 8:105021604-105021626 TTGCTGCATCCTCTGGAGAAAGG - Intronic
1047020034 8:120765557-120765579 TTGCTGCATCATCCTATGGTGGG + Intronic
1047183429 8:122610987-122611009 TTGCTGCAGCCTCACATGGTGGG - Intergenic
1050965772 9:11800127-11800149 TCACTGTATCCTTATGAGGTAGG - Intergenic
1050975244 9:11929035-11929057 TAGCTGCCTCCTCATGGGGCAGG - Intergenic
1051417377 9:16856206-16856228 TTGCTGCTTCCTTATGGGGGAGG - Intronic
1053459651 9:38258419-38258441 ATGCTGCATCCTCTGGAGGGGGG + Intergenic
1053474992 9:38376280-38376302 TTGCTGTGTCCTCACAAGGTAGG - Intergenic
1055305876 9:74928487-74928509 TTGCTGCATACTCTGGAGGAAGG - Intergenic
1058222036 9:102314341-102314363 TTCCTGCATCATCATGACCTGGG + Intergenic
1058441623 9:105013689-105013711 TTGCTGCATCCTAGAGATGTTGG + Intergenic
1059416753 9:114167316-114167338 TTGTTACATCCTTCTGAGGTTGG + Intronic
1203750632 Un_GL000218v1:75920-75942 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1203483360 Un_GL000224v1:28428-28450 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1203709337 Un_KI270742v1:82143-82165 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1203541746 Un_KI270743v1:95426-95448 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1188007233 X:25023596-25023618 ATGTTTCATCCTCATGAGGTGGG + Intergenic
1188993030 X:36847356-36847378 TTGCTGCTGCCGCATGAGTTGGG - Intergenic
1189290082 X:39878601-39878623 TTGGTTCTTCTTCATGAGGTTGG + Intergenic
1192344367 X:70289250-70289272 TGGATTCCTCCTCATGAGGTGGG - Exonic
1193284955 X:79701427-79701449 TTGTTCCATCCTCAAGAGGAAGG - Intergenic
1193439904 X:81527249-81527271 TTGCTGTATCCTCAAGATTTAGG + Intergenic
1194689882 X:96970903-96970925 TTGCTGCATCCTCAAGATTTTGG + Intronic
1196902853 X:120402982-120403004 TTGCTGCATCCTCACATGGCAGG + Intergenic
1199697819 X:150355815-150355837 TTGCAACAACCTGATGAGGTGGG + Intergenic
1200153762 X:153964426-153964448 TTGCTGCCTTCTTCTGAGGTGGG + Intronic
1200747106 Y:6911908-6911930 TTGCTACAGCAACATGAGGTCGG - Intronic
1201164289 Y:11193597-11193619 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1201767144 Y:17582599-17582621 TTGCTACATTCTCATGATGATGG - Intergenic
1201834409 Y:18323386-18323408 TTGCTACATTCTCATGATGATGG + Intergenic